Spiral

1

Ando and Miyashita followed the waitress to a table by the window. The restaurant was on the top floor of the university hospital and boasted a fantastic view of the Outer Gardens of Meiji Shrine. In addition, university employees got a discount. Both men had taken off their lab coats before coming, but still the waitress could tell at a glance that they weren’t members of the general public visiting a patient. She handed them the special employees’ lunch menu. Merely glancing at it, both Ando and Miyashita ordered the special of the day and coffee.

As soon as the waitress left, Miyashita said, with a portentous air, “I read it.” From the moment Miyashita had asked him to lunch, Ando had known he’d start out with that phrase. Miyashita had read Asakawa’s Ring report and was now ready to comment on it.

“So what did you think?” Ando leaned forward.

“I won’t lie. I was amazed.”

“But do you believe it?”

“Hell, it’s not a question of belief. It all adds up. The names of the victims and the times of death he gives check out. We’ve seen the incident reports and the autopsy records ourselves, you and I.”

He was right, of course. They had copies of the coroner’s reports and associated documents for the four victims who’d been at Villa Log Cabin. The times of death given therein accurately reflected what Asakawa had written. There were no inconsistencies to be found. But what took Ando aback was how a pathologist as sharp as Miyashita showed no apparent resistance to the idea of curses and supernatural powers playing a role in all this.

“So you just accept it?”

“Well, it’s not as if I don’t have reservations. But, you know, when you really think about it, modern science hasn’t managed to come up with answers to any of the most basic questions. How did life first appear on earth? How does evolution work? Is it a series of random events, or does it have a set teleological direction? There are all kinds of theories, but we haven’t been able to prove one of them. The structure of the atom is not a miniature of the solar system, it’s something much more difficult to grasp, full of what you might call latent power. And when we try to observe the subatomic world, we find that the mind of the observer comes into play in subtle ways. The mind, my friend! The very same mind which, ever since Descartes, proponents of the mechanistic view of the universe considered subordinate to the body-machine. And now we find that the mind influences observed results. So I give up. Nothing surprises me. I’m prepared to accept anything that happens in this world. I actually kind of envy people who can still believe in the omnipotence of modern science.”

Ando himself had at least a few doubts about the so-called omnipotence of modern science, but evidently they weren’t as grave as Miyashita’s. How could one feel comfortable in the scientific community if one harbored that kind of skepticism?

“That’s pretty extreme.”

“I’ve never told you this, but I’m actually a philosophical idealist.”

“An idealist, huh?”

“Like the Buddha said, form is empty and emptiness is form.”

Ando wasn’t quite sure what Miyashita was trying to say. He was sure that between philosophical idealism and reality is empty there was a lot being left unsaid, but now wasn’t the time to pursue the finer points of Miyashita’s worldview.

“Anyway, was there anything that particularly bothered you about the report?” Ando wanted to see if he and Miyashita harbored the same doubts about it.

“Oh, any number of things bothered me.” The coffee arrived, and Miyashita stirred his full of cream and sugar. His ruddy face caught the sun full-on through the window. “First, why is Asakawa and only Asakawa still alive after having seen that videotape?”

Miyashita took a sip of coffee.

“It’s because he figured out the charm, no?”

“The charm?”

“You know, the part that had been erased at the end of the tape.”

“The bit that wanted to force the viewer to do something.”

“So if Asakawa did it without realizing it…”

“Did what?”

“It was right there at the end of the report, wasn’t it? ‘The nature of a virus is to reproduce itself. The charm: make a copy of the video.’”

Then Ando explained to Miyashita a few things he didn’t know. There had been a video deck in Asakawa’s car at the time of the accident, and Ando had found a taped-over copy of the videotape in Mai’s apartment.

A light seemed to go on in Miyashita’s head. “A-ha, so that’s what he meant. Asakawa thought the charm was to make a copy of the video and to show it to someone who hadn’t seen it yet.”

“I have no doubt that’s what he thought.”

“So, where was he heading with the VCR on the morning of the accident?”

“Someplace where he could find two people who would watch the tape, of course. He must have been desperate to save his wife and young daughter.”

“But he’d have had a hard time showing such a dangerous tape to a complete stranger.”

“I imagine he went to his wife’s parents. It couldn’t have been his own parents, since his father’s still alive and well. I spoke to him on the phone just the other day.”

“So her parents exposed themselves to a temporary risk in order to save their daughter and granddaughter.”

“Looks like we need to find out where they live and check with the local police.”

If the video, complete with extortionate addendum, had been reproduced and circulated, then there might well be more victims in the area around Shizu Asakawa’s parents’ house. But if there were, the media hadn’t picked up on them yet. The video’s progress was still below the surface, out of the public eye.

Miyashita, too, seemed to have arrived at the thought that the videotape had the ability to spread like a virus. He spoke mockingly. “Looks like you’ll be cutting up a lot of bodies.”

This jolted Ando into a realization. Judging from the situation, it was more than likely that Mai had watched the tape. It was now almost two weeks since she’d disappeared. Perhaps he’d end up dissecting her himself. He imagined her beautiful form on the operating table, and it horrified him.

“But Asakawa’s still alive.” He said it like a prayer.

“The biggest problem we have is this: if Asakawa did manage to make two copies of the videotape, why did his wife and daughter die?”

“Put another way, why is Asakawa himself still alive?”

“I don’t know. The smallpox virus is tangled up in this, right? In light of that, it makes perfect sense for this ‘charm’ to be copying the video to help it propagate.”

“It makes sense up through Ryuji’s death. But the deaths of Asakawa’s wife and daughter throw the question wide open all over again.”

“So, being copied wasn’t what the tape wanted?”

“I don’t know.”

He didn’t know how to interpret the situation. Either the charm had aimed at something else, or something untoward had happened in the copying process. Or maybe the tape killed people who watched it regardless of whether or not they enacted the charm. But that would make it even harder to explain why Asakawa survived.

Lunch arrived, and the two men fell into silence for a while, absorbed in eating.

Finally, Miyashita rested his fork and said, “I find myself in a dilemma.”

“What do you mean?”

“Well, if there is such a videotape, I’d want to watch it. But it might kill me. I’d say that’s a dilemma. A week’s not much time.”

“Not much time?”

“To figure it out. It’s really intrigued me. Scientifically speaking, what we have here is a video, a medium that attacks the human brain through its sense of sight and sound, which can somehow implant a smallpox-like virus inside the body.”

“Maybe it wasn’t that it implanted it. Maybe the images on the video somehow influenced the victim’s cellular DNA so that it metamorphosed into the mystery virus.”

“You might have something there. I’m thinking of the AIDS virus. We don’t know its origins for sure yet, but it’s thought that something caused human and simian viruses that had existed all along to evolve, and that’s what gave birth to the AIDS virus as we know it. In any case, AIDS is not a virus that has been around for hundreds of years. Analysis of its base sequences clearly shows that it’s something that branched into two strains only about a hundred and fifty years ago. Through some chance event.”

“And you want to find out what that chance event is in this case.”

“Me, I think it involves the mind.” Miyashita leaned forward until his nose almost touched Ando’s.

It was, of course, common knowledge that the mind, as abstract and immaterial as it was, could influence the body in various ways. Ando was well aware of this. One only had to think of how stress could eat holes in the stomach lining. Now Ando and Miyashita were thinking along the same lines. First, the video created in the viewer a particular psychological state that somehow influenced the viewer’s own DNA to metamorphose until the mystery virus which resembled smallpox was born. Then, this smallpox-like virus caused a cancer inside the coronary artery that surrounds the heart, resulting in a tumor. In a week’s time the tumor reached its peak size, cutting off the flow of blood and stopping the heart. But the virus itself was like a cancer virus-its function was to worm its way into the DNA and cause cellular mutation in the coronary arteries tunica media-and wasn’t very contagious. At least, that was what their analysis so far had led them to think.

“Come on, don’t you want to see it?” challenged Miyashita.

“Well…”

“I just want to get my hands on that tape.”

“No, I think it’s best to let sleeping dogs lie. You’d end up like Ryuji.”

“Speaking of Ryuji, did you manage to break the code?”

“Not yet. Even if it is a code, forty-two bases is too small a number to work with. It could only contain a few words at most.”

This was an excuse. Ando had in fact tried several times to decipher the code, but every attempt had ended in failure.

“I guess I know how you’ll be spending your holiday.”

That was when Ando first realized that the next day was a national holiday, Labor Thanksgiving Day. And since he didn’t have to work the following day, Saturday, it meant he had a three-day weekend coming up. Ever since losing his son and his wife, he hadn’t paid much attention to holidays. It was nothing but misery to be home alone, and three-day weekends that he had no plans for made him particularly depressed.

“Yeah, well, I’ll give it a shot.”

But spending the holiday trying to read a coded message from a dead man sounded pretty dismal. On the other hand, if he succeeded, then maybe it’d give him some sense of accomplishment. At least it would provide a distraction.

So he promised Miyashita that he’d have it figured out by the end of the weekend. “On Monday, I’ll tell you what Ryuji’s trying to say.”

Miyashita reached across the table and clapped a hand on Ando’s left shoulder. “It’s up to you now.”

2

After lunch, Ando went back to his office and put in a call to the Forensic Medicine Department of Joji University Hospital, in Utsunomiya, Tochigi Prefecture. A little research had turned up the information that Asakawa’s wife’s parents lived in Ashikaga, Tochigi. Any unexplained deaths in that region would fall under the jurisdiction of the doctors at Joji.

An assistant professor came to the phone, and Ando asked him if there had been any patients who’d died late last month from heart attacks caused by blockage of the coronary artery. The man responded with a curt question of his own. “Sorry, but what are you getting at?” Ando explained to him that they had seen seven deaths from the same cause in the greater Tokyo area, and there were indications that there could be many more victims. He avoided any mention of paranormal phenomena.

This didn’t seem to have assuaged the man’s doubts. “So you’re contacting medical schools across the region?”

“No, not exactly.”

“So why are you calling us?”

“Because your area is at risk.”

“Are you saying we’re going to find bodies in Utsunomiya?”

“No, in Ashikaga.”

“Ashikaga?” The mention of the name startled the man. He fell silent, and Ando could almost sense his grip on the receiver tightening.

“This is a shock. I can’t imagine how you know about it. As a matter of fact, on October 28th, the bodies of an elderly couple were discovered there. We did autopsies on them the next day.”

“Can you tell me their names?”

“Their last name was Oda, I think, and the wife’s name was Setsuko. I forget the husband’s name.”

Ando had already checked on Shizu Asakawa’s parents’ names: Toru and Setsuko Oda. It had to be them. Now they had proof. On the morning of October 21st, Asakawa had loaded a VCR into his rented car and driven to his in-laws’ house in Ashikaga, where he’d had two copies made of the tape and shown to the old couple. No doubt he’d assured them that if they made more copies and showed them to other people within a week, their lives wouldn’t be in any danger. They probably hadn’t needed much convincing, regardless of whether or not they fully believed in their son-in-law’s outlandish story. If there was any chance that their daughter and granddaughter’s lives were on the line, they must have been more than willing to acquiesce. And so Asakawa had had copies made, believing that by doing so he’d saved his wife and child. But on the way home he lost them both at once, and then a week later, the old couple died, too.

“I’ll bet you were pretty surprised by what you found in the autopsy.” Ando could well imagine the staff’s shock at finding the same symptoms in both bodies.

“You can say that again. I mean, given the simultaneous time of death, plus the fact that they left a note, we naturally assumed it was a double suicide. But then we cut them open, and found, instead of poison, strange tumors in their coronary arteries. Surprised isn’t the word.”

“Hold on a minute,” Ando broke in.

“What?”

“You say they left a note?”

“Yes. It wasn’t much of one, but a note was found next to their pillows. It looked like they’d written it right before they died.”

Ando was disconcerted by this development. What did this mean? Why did they leave a note?

“Can you tell me what the note said?”

“Hang on.” The assistant professor put down the receiver, but was back a few seconds later. “It’s going to take me a while to locate it. Shall I fax it to you later?”

“I’d appreciate that.”

Ando told the man his fax number and then hung up.

He couldn’t leave his desk after that. The fax machine was on the middle shelf of a computer cabinet two desks away. He swiveled in his chair forty-five degrees to face the fax machine, and then waited for the transmission to arrive.

He couldn’t relax; he couldn’t even lean back in his chair. Instead, while he waited, he went over the course of events up to now in his head. Reviewing the past was all he could do. He was too distracted wondering when the fax machine would come to life to start a new train of thought.

Finally, the machine started to buzz and a fax began to roll out. He waited until it was finished, then got up and tore it off. He returned to his seat, spread the fax open on his desktop, and read:

Under the professor’s scrawled note were a few lines of text accompanied by the Odas’ names. The handwriting wasn’t Yokota’s; he must have made a photocopy of the original.

The message was short, but even so it was enough to make it clear that they knew they were facing death. Yoshimi and Kazuko were probably their other two daughters. But who had the previous sentence been addressed to?

What did they mean, they’d disposed of the videotapes?

Did it mean they’d gotten rid of them? It certainly couldn’t be taken to mean that they’d copied them.

Ando decided to try and recreate the Odas’ state of mind from the beginning.

On Sunday, October 21st, their son-in-law showed up on their doorstep and told them that Shizu and Yoko’s lives were threatened by a curse embedded in a videotape. The Odas agreed to copy the tape. But then, that same day, Shizu and Yoko died at the time foretold. Even if the Odas had been skeptical about Asakawa’s story at first, now they surely had to believe in the video’s power. Then, after the funeral, they had learned the results of the autopsies: inexplicable heart attacks. At this point the Odas must have decided to give up hope of saving themselves. Their daughter and granddaughter had lost their lives in spite of the fact that they’d followed the videotape’s demands. The Odas must have thought that they couldn’t escape death no matter what they did. Exhausted from all the effort that had gone into the funerals, and perhaps weary of life in general, they decided to refrain from copying the videotape and meekly awaited the approach of death. But if their note was to be believed, while waiting, they had “disposed” of the videotapes that were the source of all this misery.

There was no way for Ando to know how they had disposed of the tapes. They might have erased them completely and then thrown them away, or they might have buried them in the yard. In any case, as Ando now attempted to diagram the video’s path on a piece of scratch paper, he decided to grant for the moment that those two copies had been obliterated.

First there had been the one in Villa Log Cabin No. B-4, the source of all the evil, created when a VCR left to record had captured the images on tape. Asakawa had taken that back to his apartment and made a copy for Ryuji. At this point there were two copies, two strains as it were. However, it seemed that Ryuji’s copy had found its way into Mai’s hands, and had then been erased, all except for the first ten seconds. Asakawa’s copy, meanwhile, had passed to his brother Junichiro, who had discarded it along with the damaged VCR. Asakawa’s original had begotten two further strains in the form of copies given to the Odas, but these too had been disposed of. In short, the videotapes born of Sadako Yamamura’s wrath had now vanished from the face of the earth.

Ando went over the tree he’d constructed again and again, to make sure he had it right. But the tape did indeed seem to have gone extinct. A mere two months after it had come to life at the end of August, having claimed only nine victims, the scourge had died out. But… Ando thought. If the videotape killed everybody who watched it regardless of whether or not they copied it, it was obvious that it was going to go extinct sooner or later. Only by virtue of its threat would it be able to reproduce itself, to adapt to its environment and survive. Once the threat was exposed as a lie, the tape would inevitably be driven into a corner.

If it was extinct, that would mean they’d seen the last of these mysterious deaths. If nobody else could be exposed to those images, then there was no fear of anybody dying from inexplicable heart attacks. But a fundamental point now stole back into Ando’s mind.

Why is Asakawa still alive?

This was followed by another question.

Where is Mai Takano?

Logically, the videotape seemed to have died out. But Ando’s intuition denied it. This wasn’t going to be over that easily. Something didn’t sit right.

3

Ando picked up a locker key at the front desk of the library, and then took off his jacket on his way to the lockers. It was almost winter. Anybody who saw him, wearing nothing but a shirt, would shiver in sympathy. But Ando perspired easily, and even in his shirtsleeves, he felt hot in the climate-controlled library. He took a pen and a notebook out of his briefcase, then wrapped his jacket around it and stuffed it in a locker.

The notebook was where he’d put the page containing the DNA analysis of the virus found in Ryuji’s blood. Ando was determined to have a go at cracking the code today, which was why he was here in the library first thing in the morning, but the moment he looked at the meaningless array of letters on the printout, his eyes glazed over. There was no way he’d be able to figure this out. But when he thought about it, he recalled that he was doing this partly to kill time. He couldn’t think of anything better to get him through the empty three-day weekend.

So he tucked the notebook under his arm and headed up to the third-floor reading room, where he took a seat by the window.

As a student playing at cipher-cracking with Ryuji, he’d had quite a collection of books on cryptography at home. But what with getting married and then getting divorced, he’d moved three times since then, not to mention the fact that he’d lost interest in the subject; all those books had disappeared somewhere along the line. There were certain types of codes that he couldn’t hope to decipher without the help of character substitution charts and letter-frequency graphs of the kind found in specialist works, and he doubted he’d be able to get anywhere on this one without their help. And since it just seemed foolish to buy them all over again, he’d ended up at the library.

At one point he’d had a good grasp of the basics of constructing and unscrambling codes, but it had been ten years, so he first took a quick glance through a primer on the subject. He decided that his first step should be to decide just what class of code was contained in the smallpox-like virus’s base sequence.

Codes can be generally divided into three types: substitution ciphers, in which the letters of the message are replaced by other letters, symbols, or numbers; transposition ciphers, in which the order of the words of the message is changed; and insertion ciphers, in which extraneous words are inserted between the words of the message. The numbers that popped out of Ryuji’s belly after the autopsy, which Ando was able to link to the English word “ring”, was a good example of a simple substitution cipher.

It didn’t take him long to guess that the virus’s code had to be of the substitution variety. What he had to work with was a group of four letters, ATGC, corresponding to the four bases, so it was most likely that the code consisted of assigning a particular character to a predetermined grouping of letters. That was most code-like.

Code-like. When the thought occurred to him, it made him sit up and think. The essential purpose of a code is to convey information from one party to another without any third party being able to figure it out. As students, codes had been nothing but a game to them, brain-teasers. But in, say, times of war, when a code’s susceptibility to deciphering could sway the tide of a conflict, a “code-like” code would mean one which was, in effect, too dangerous to use. In other words, one way to keep the enemy from breaking your codes was to make sure they didn’t look like codes at first glance. If you caught an enemy spy and found he was carrying a notebook filled with suspicious looking strings of numbers, it would be a safe bet that it was top-secret informatin, encrypted.

Even allowing for the possibility of decoys, when a code is identified as such, the chances of it being broken rise significantly.

Ando tried to think logically. If the purpose of a code is to keep information from the hands of a third party, then a code should only seem “code-like” to the person for whom the information is intended. Staring at the forty-two letters interpolated into the base sequence of the virus, Ando found them extremely code-like. That had been his impression from the very first time he’d looked at the chart.

Now why would that be?

He tried to analyze the source of that impression. Why did it seem code-like to him? It wasn’t as if there had never been puzzling repetitions found in the course of DNA sequencing. But in spite of that, this particular repetition seemed meaningful. It popped up everywhere they looked in the sequence, no matter where they sliced it. It was as if it was trying to call attention to itself, saying, I’m a code, dummy. The sequence of letters seemed particularly code-like to Ando in light of his experience with the numbers that had popped out of Ryuji’s belly. In other words, maybe there had been two purposes to the word “ring” squeezing its way out just then: not only was it meant to alert Ando to the existence of the Ring report, but it was also a form of warning. It was as if Ryuji were telling him, I may use codes again as the situation warrants, so keep your eyes peeled and don’t miss them. And maybe he’d used the simplest kind of substitution cipher as a hint, too.

Given that the mysterious string of bases had only been found in the virus drawn from Ryuji, it was safe to assume that he was the one sending the code. It was an undeniable fact, of course, that Ryuji had died and his body been reduced to ashes, but a sample of his tissue still remained in the lab. A countless number of instances of his DNA, the blueprint for the individual entity that was Ryuji, still remained in the cells in that tissue sample. What if that DNA had inherited Ryuji’s will, and was trying to express something in words?

It was a nonsensical theory completely unworthy of an anatomist like Ando. But if he did succeed in making the string of letters yield words by means of substitution, then that would trump all other readings of the situation. Theoretically, it was possible to take DNA from Ryuji’s blood sample and use it to make an individual exactly like Ryuji-a clone. This assemblage of DNA sharing the same will had exerted an influence over the virus that had entered its bloodstream, inserting a word or words. Ando could suddenly sense Ryuji’s cunning and sheer genius behind this. Why had he inserted the message only into the virus, an invader, and not into his red blood cells? Because, with his medical background, Ryuji knew that there was no chance that DNA from the other cells would be sequenced. He’d known that he could only count on the virus responsible for the cluster of deaths being run through a sequencer, and so he’d concentrated his efforts on the virus’s DNA. So that the words he sent would be received.

All of which finally led Ando to one conclusion. Since this code looked to him like a code, it was no longer functioning, in essence, as a code should. Rather, it was just that Ryuji’s DNA had no other way to communicate with the outside. The DNA double helix was composed of four bases represented by the letters ATGC. Ando couldn’t think of any other way for it to make its will known but by combining those four letters in various ways. It had chosen this way because there was no other available to it. It was the only means Ryuji had at his disposal.

Suddenly all the despair Ando had felt a few moments ago was gone, replaced by a buoying confidence.

Maybe I’ll be able to decipher this after all.

He felt like shouting. If Ryuji’s will, lingering in his DNA, was trying to speak to Ando, then it stood to reason that the words it used would be ones easy for Ando to decode. Why should they be more difficult than they needed to be? Ando went back and checked his line of reasoning to see if there were any holes in his deductions. If he started off on the wrong foot, he could wander around forever without finding the answer.

He no longer saw what he was doing as merely a way of killing time. Now that he felt that he would actually be able to decipher the message, he couldn’t wait to find out what it said.

The rest of the morning, until lunchtime, Ando spent working on two approaches.

The sequence he had to work with was:

ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA

The first question was how to divide the letters up. He tried dividing them up in twos and in threes. First, by twos:

Taking a pair of letters as one unit, the four letters available yielded a possible sixteen different combinations. He wondered if each combination might represent one letter.

But this immediately led him to another problem: what language was this message written in?

It probably wasn’t the Japanese syllabary. There were nearly fifty characters in that, far more than the sixteen allowed by the pair method. The English and French alphabets both had twenty-six letters, while Italian only used twenty. But he also knew he couldn’t overlook the possibility that the message was in romanized Japanese. Identifying the language of a code is sometimes half the battle.

But this was a problem that had already been solved for Ando. The fact that he’d been able to replace the numerals 178136 with the word “ring” could probably be taken as a hint from Ryuji that the present code would also yield something in English. Ando was sure of this point. And so the question of language was as good as settled.

The forty-two base letters could be split into twenty-one pairs. But several pairs were identical: there were four AA’s, three TA’s, three TC’s, and two CC’s. There were only thirteen unique pairings. Ando jotted these numbers down on a piece of paper and then paged through a book on code-solving until he found a chart showing the frequency of appearance in English of different letters of the alphabet.

He knew that although the English alphabet contains twenty-six letters, not all of them occur in equal numbers in everyday use. E, T, and A, for example, are common, while Q and Z might appear only once or twice per page. Most handbooks on code-breaking will include various kinds of letter frequency charts in the back, among other statistical references. Using such tables and statistics made it easier to determine the language a coded message was in.

In this case, what the figures told him was that in an English phrase of twenty-one letters, the average number of different letters used was twelve. Ando clicked his heels. What he had was thirteen different letters, not far off the average at all. This told him that, statistically speaking, there was nothing wrong with him dividing the sequence into twenty-one pairs and assuming that each pair stood for a letter.

Putting that possibility on hold for a moment, Ando next tried dividing up the sequence into sets of three:

ATG GAA GAA GAA TAT CGT TAT ATT CCT CCT CCT CAA CAA CAA

This produced fourteen trios, or seven unique varieties: GAA, TAT, CGT, ATT, CCT, and CAA. The charts told him that an English phrase of fourteen letters contained an average of nine different letters. Not far off from the seven he had.

Ando immediately noticed that there was a lot of overlap produced by this system. GAA, CCT, and CAA each occurred three times, and TAT appeared twice. But what really bothered Ando was the fact that GAA, CCT, and CAA each appeared three times in a row. If he assigned each triplet a single letter of the alphabet, there were three separate cases in this short passage of the same letter being repeated three times. He knew enough English to know that double letters were not at all uncommon. But he couldn’t think of any English words with triple letters. The only possibility he could think of was situations in which one word ended with a double letter and the next word began with the same letter, e.g., “too old” or “will link”.

He picked up an English book he happened to spy nearby and started examining a page at random to see just how often the same letter occurred three times in succession. He’d gone through four or five pages before he found a single instance. The chances of it happening three times in one fourteen-letter sequence were basically nil, he concluded. By contrast, dividing up the forty-two letters into pairs produced just one double letter. As a result, he decided that statistically it made more sense to go with the first option and divide the bases into pairs of letters.

He’d narrowed down the possibilities. From here he could proceed through trial and error.

The AA pair appeared four times, which meant it must correspond to a letter used with great frequency. Consulting another chart, Ando confirmed that the most frequently used letter in English is, of course, E. So he hypothesized that AA stood for the letter E. The second most common pairs in his sequence were TA and TC, occurring three times each. He also noticed that AA was followed by TA once, while TC was followed by AA once. This might be important, since there were also statistics for various combinations of letters. He started trying out various possibilities for TA and TC, constantly referring to his charts.

As far as letters which often follow the letter E and which are also common in and of themselves, the letter A seemed like the best candidate, which meant that TA could stand for A. By the same logic, he thought that TC might correspond to the letter T. Further, by the way it combined with other letters, he guessed that CC might be N. Thus far the statistics seemed to be serving him well. At least, he hadn’t run into any problems.

This is what he had:

_ _E_ _EAT_AA_NT_ NTE_ _E

What had once seemed a random jumble of letters now seemed to be taking on the aura of English. Next he tried filling in the blanks based on what he knew of consonant-vowel combinations, always consulting the charts.

SHERDEATYAALNTINTECME

The first three letters seemed to form the word “she”, but the rest of it didn’t form words no matter how he divided it up. He tried switching the positions of the E’s, A’s, T’s, and N’s, and changed other letters around on hunches. When it became too time-consuming to write down the possibilities on paper, he tore sheets out of his notebook, first to make twenty-six cards, one for each letter. It was beginning to feel like a game.

THEYWERBORRLNBINBECME

When he hit on this combination, the first thing that popped into Ando’s mind was the phrase “they were born”. He knew the spelling was a bit off, but maybe it wasn’t too much of a stretch. And the meaning struck a chord with him somehow. But he had a feeling there was a better match out there somewhere, so he kept at the game.

After about ten minutes of playing around, Ando thought he could guess what the result would be, and he stopped. If he had a computer with him, things would be much easier, he thought. The third, sixth, eighteenth, and twenty-first letters were the same. The seventh, tenth, and eleventh were the same. The eighth, fourteenth, and seventeenth were the same. The thirteenth and the sixteenth were the same. The phrase was twenty-one letters long. If he fed those conditions into a computer it would probably come up with the answer, provided he made the proper adjustments for frequency of letter usage. But the computer would undoubtedly come up with several possible solutions. There had to be an infinite number of meaningful phrases in English that satisfied those conditions. How would he be able to tell which one was Ryuji’s message to him? Only if there was something about the right answer that would tell him at first glance that it was from Ryuji, like a signature at the end of a letter. But if there wasn’t, he’d be lost.

Ando realized he was at a dead end. He hung his head, feeling stupid that it had taken him this long to notice. Back in his student days, when his code-breaking intuition had been more finely honed, he would have caught on to this impasse in a minute or two. He’d have to change the way he thought about this. He needed a new hypothesis.

Ando was so absorbed he hadn’t noticed the passage of time. He looked at his watch now to find it was nearly one in the afternoon. He realized he was hungry. He stood up, thinking to go have lunch in the cafeteria on the fourth floor. A change of surroundings would do him good. Trial-and-error and inspiration: he was going to need both if he was going to come up with a solution. And he often got his inspirations while he ate.

The answer to this is going to have to be obvious.

He whispered it almost like an incantation as he headed for the fourth floor.

4

As he ate the set lunch, Ando gazed out the window at the trees down below, and at the kids playing on the swings and the seesaws in the park. It was past one now. The cafeteria had been packed when he arrived, but now there were empty seats here and there. The printout with the base sequence sat on the table next to his aluminum tray, but he wasn’t looking at it.

One wall of the cafeteria had floor-to-ceiling windows, so there was nothing to obstruct his view of the children playing. It was like watching a silent movie. Whenever he saw a boy of about five, Ando’s gaze was riveted to him. Without even realizing it, he’d stare at the child, and it would take him several minutes to snap out of it.

He’d come to this library with his son once. It was a Sunday afternoon two years before, when they were living in the South Aoyama condo. Ando had suddenly realized he needed to look up some data for a presentation he was scheduled to give at a research conference, so he decided to come to the library. He took Takanori along for the walk. But when they got there, a sign at the entrance said NO ONE UNDER 18 ADMITTED. He couldn’t very well make the boy wait outside while he did his research, so he gave up and they played in the park instead. He could remember standing behind the swings, pushing Takanori; he could remember the rhythm of the swing. That same swing was in motion now, under the golden gingko leaves. He couldn’t hear a sound, couldn’t even see the expressions on the faces of the children as they alternately stretched out their legs and tucked them in. But in his mind’s ear he could hear his son’s voice.

But he was getting off track. He brought his gaze back to the page and picked up his pen.

It was time to get back to the basics of code-breaking. There was no other way to crack this kind of code but to come up with several hypotheses, and then pursue each one of them in turn. When it became clear that one theory wasn’t working out, the best thing to do was abandon it with alacrity and move on to the next one. For a message of only twenty-one letters, he wouldn’t be able to rely solely on frequency charts and letter-combination rules. In fact, if the code was complicated enough to require a specific conversion key, it ran the risk of being too hard, in which case it wouldn’t be able to convey what it wanted to. No, he needed to simply work through a bunch of theories by trial and error. If an idea wasn’t working, he needed to abandon it, that was all.

There was one hypothesis that Ando thought he had abandoned too soon, though. It occurred to him that the code might be an anagram.

He returned to the reading room and once again split the forty-two letters into groups of three.

ATG GAA GAA GAA TAT CGT TAT ATT CCT CCT CCT CAA CAA CAA

He’d abandoned this approach because it resulted in triple repetitions of the same letter, a very unusual thing in English. But what if the letters themselves needed to be rearranged? He thought of an example he’d read once, where the phrase “Bob opened the door” had been encoded as OOOOEEEBBDDTPNHR. As it was, the sequence contained far too many letter repetitions to make sense as English, but when rearranged according to a certain set of rules, it yielded a perfectly normal sentence.

This might work, he thought.

But just as he was about to get to work, he stopped. He could see where this was going, too. If he not only had to decide what letters each triplet stood for, but also had to figure out how to rearrange the letters, the task suddenly became a mammoth one. And it wasn’t just a question of time. Without a key of some sort, he’d end up with the same sort of problem he had run into earlier: a plethora of possible solutions with no way to choose among them. He thought of the numbers that had led him to “ring” and wondered if they might somehow be that key, pointing him toward the right order in which to arrange the letters now. But first he’d have to figure out what letters the triplets stood for.

Another dead end.

You need a fresh angle on this, Ando told himself. He was trying to proceed by trial and error, but he felt like he was just trying the same thing over and over. Maybe he was too fixated on the idea of making each set of two or three bases correspond to one English letter.

The solution has to be something unambiguous, something that I can figure out without going through a long, complicated process.

He felt his concentration faltering, his eyes wandering away from the page. He suddenly realized he was staring at the hair of a young woman seated at the other end of the same table. With her head down like that, she looked like Mai Takano, especially her forehead.

Where is she now?

He worried about her safety, especially when he considered that she used to be Ryuji’s lover.

Could Ryuji be trying to tell me where she is with this code?

He considered the possibility for a moment, but then discarded it with a derisive laugh as being too comic-book. How adolescent, to imagine himself as the famous detective out to save the heroine from mortal danger. Suddenly the whole thing seemed foolish to Ando. This probably wasn’t a code at all. There was probably a perfectly scientific explanation for how that sequence of bases got into the virus’s DNA. And once Ando admitted that possibility, he could feel his passion for code-breaking vanish. He was just killing time anyway, right? He was working awfully hard at it.

The setting sun was turning the hairs on his upper arm golden. All the intensity he’d had that morning was gone now. He thought about moving to another seat, where the sun didn’t hit him, and started to get up. Looking around, though, he saw he was surrounded by kids, college students or high school kids studying for entrance exams, all dozing behind mountains of books. Moving wouldn’t help him get his concentration back. The entire reading room was enveloped in drowsiness. Ando sat back down where he was.

Think about it logically, he told himself. There has to be a formula.

He sat up straight. He’d been trying to assign letters of the alphabet to trios of bases, but that didn’t work out to a formula. If he could get it down to a one-to-one function, or even a several-to-one function, then the answer would become obvious. One-to-one, perhaps several-to-one… There had to be a formula like that to be discovered.

He stood up. Logically speaking, there was no other way. His intuition told him that he’d moved one step closer to a solution, and the realization blew away his torpor, spurring him to action.

He went to the natural sciences section, found a book on DNA, and started flipping madly through the pages. As his excitement mounted, his palms grew sweaty. What he was looking for was a chart that gave what amino acid each trio of bases formed.

Eventually he found one. He took the book back to his table and laid it out flat, opened to the chart, next to the coded message.

When a trio of bases, a codon, forms a protein, the codon is translated into an amino acid. The principles by which the translation takes place were contained in the chart Ando had found. There are twenty varieties of amino acid. There are four bases, meaning there are sixty-four separate combinations of three that can be formed. With sixty-four combinations standing for only twenty amino acids, it meant there was quite a bit of overlap. It was several-to-one mapping. Each trio of bases signified one amino acid or another (or a stop).

Consulting the chart, Ando wrote the abbreviated names of the amino acids below the forty-two bases of the code.

Next he took the first letter of the name of each acid and lined them up:

MGGGTATIPPPGGG

But this meant nothing. And he was still faced with triple letter combinations. It seemed he’d have to figure out what to do with them no matter what. There had to be another interpretation. For example, maybe a third straight repetition of the same letter meant that the first two should be interpreted as a space between words.

He tried that:

MG TATIP G

That wasn’t English either.

But all the same, Ando felt he was getting somewhere. He could tell he was closing in on the solution. He didn’t know why, but he felt that any minute now he’d come up with a word that made sense.

Met, Pro, and Gin were the ones that were repeated three times. He tried writing them out a different way:

He stared at this list for about a minute, and then he saw an English word he knew.

It occurred to him that the codons repeated three times might signify not “three” but “third”. As in, the third letter of the abbreviation for the amino acid.

In other words:

Which meant the solution was: Mutation.

Forgetting where he was, Ando let out a groan. The only answer he’d been able to come up with, as a result of logic, method, and trial and error, was this. It was a simple, clear answer, and it had to be right.

But still he had to hang his head. He knew the meaning of the English word “mutation”-that is, he knew what it meant in an evolutionary biological sense. But he had absolutely no idea how he was supposed to take it in this context.

Just what the hell are you trying to say, Ryuji? He didn’t speak the question aloud. But even in his own head, Ando could hear his voice tremble with excitement at having decoded the message.

5

He went to the hall, found a pay phone, and dialed Miyashita’s number. He doubted his friend would be in, given it was a Saturday evening in the middle of a three-day weekend, but lo and behold, Miyashita was at home with his family. Ando was able to tell him that he thought he’d deciphered the code.

Ando figured Miyashita was probably in his living/dining room; in fact, he could practically see Miyashita’s wife and children getting ready for dinner. Miyashita himself was cupping a hand around the mouthpiece to keep out the background noise but was unable to keep his halcyon home life from filtering through.

“Good show! That’s excellent. What did it say?”

Miyashita had a loud voice to begin with, and with his hand cupped around the mouthpiece it rang even louder in Ando’s ears.

“Well, it wasn’t a sentence. It was just a single word.”

“Okay, so it was only one word. What was it?”

“Mutation.”

“Mutation?” Miyashita repeated the word several times, as if trying it on for size.

“Do you have any idea what it might mean?” Ando asked.

“I don’t know. How about you? Any ideas?”

“Not an inkling.”

“Listen. Why don’t you come over?”

Miyashita lived in a tasteful condo in North Terao, in Tsurumi Ward in Yokohama. Ando would have to take the train to Shinagawa and transfer to the Keihin Express Line, but he’d be able to get there in less than an hour.

“Alright, I guess.”

“Call me when you get to the station. I know a good bar near the station where we can knock one back and talk it over.”

Miyashita’s kindergarten-age daughter seemed to have guessed he was planning to go out. She clung to his waist and whined, “Stay home, Daddy!” Out of respect for Ando, Miyashita clapped his hand over the receiver and scolded her. Ando could hear him wandering around the house with the phone, trying to get away from her. Ando felt guilty, even though it hadn’t been his idea to go out in the first place. At the same time, he felt an ineffable sense of loss and envy.

“We can do it another time if you want.”

But Miyashita wouldn’t hear of it. “No way. I want to hear all the details. Anyway, give me a call from the station, and I’ll be right there.”

He hung up, not waiting for Ando’s reply. With a sigh of despair, Ando left the library and headed for the subway station, the harmonious sounds of his friend’s household still echoing in his ears.

Ando hadn’t taken the Keihin Express Line since visiting Mai’s apartment eight days before. From somewhere near Kita Shinagawa Station the train ran on elevated tracks. He found himself looking down on houses and the neon signs. At six on a late-November evening it was already nearly pitch-dark. Turning his gaze toward the harbor he saw the Yashio high-rise apartments straddling the canal, their lit and unlit windows forming a checkerboard pattern. A surprising number of the windows were dark for a weekend evening. Ando found himself trying to find words in the patterns of light and dark; he’d had codes too much on the brain lately. On one among the forest of buildings he thought he saw the phonetic syllable ko- child? — but of course it meant nothing.

Mutation, mutation.

He kept muttering the word under his breath as he stared into the distance. He hoped that maybe the more he intoned it the clearer Ryuji’s intent would become.

In the distance he heard a foghorn. The train slid into a station and stayed there; an announcement said they were waiting for an express to pass. Ando was on the last carriage. He stuck his head out the door to see the name of the station. Sure enough, this was where Mai lived. From the train he could see the street outside the station, lined with shops, and he started looking for Mai’s apartment, relying on his eight-day-old memories. He remembered that when he’d stood in her room and looked out the window, he’d seen the Keihin Express station at right about eye level. He could see people waiting on the platform, which meant that he should be able to see her apartment from here.

But he couldn’t see very well from inside the train, so he got off. He walked down to the end of the platform and stuck his head out over the fence. The shopping street stretched east at a right angle to the train tracks. Less than a few hundred feet away, he saw a seven-story apartment building he recognized.

Abruptly, he heard the sound of the express approaching from the direction of Shinagawa. Once it had passed, the local Ando was riding would shut its doors and continue on toward Kawasaki. Ando hurriedly looked for her window. He knew she lived in room 303, and that was the third window from the right. By now the express had passed, and the bell was ringing to announce the departure of the local. Ando looked at his watch. It was just past six. Miyashita would be eating dinner with his family right now. Ando was reluctant to arrive too early and disturb their precious family time. He figured he was about thirty minutes earlier than he wanted to be, so he decided to take the next train down. He let the local leave without him.

The third floor windows were more or less level with the platform where he was standing. He looked carefully at each of them in turn, but there was no light in any of them.

So she’s not there after all.

It had been a faint hope, easily dashed. Then, just as he was about to look away, his gaze was arrested by a band of pale blue light emanating from the third window from the right. He squinted, wondering if he was imagining it, but there it was, fluttering like a bluish-white flag. It glowed so faintly, flickering in and out of view, that he would have missed it if he hadn’t been looking so carefully. He leaned even farther forward, but it was too far away. He couldn’t quite make it out.

He wanted to go back to her apartment. It should only take twenty minutes or so, which would put him right on schedule for the next train. Without hesitating another minute, he went through the ticket gate and out into the street below.

It was only when he was standing directly below her window, looking up at it, that he was able to figure out the strange light. Her window was open, and her white lace curtain had been blown outside the window, where it was dancing in the breeze, and the neon sign of a car-rental agency across the street was reflecting off the pure white of the lace. Sometimes the primary colors shining on the white cloth showed up like fluorescent paint, which explained the pale blue tinge that was just barely visible from the station. Still, there was a lot about the scene that didn’t sit right with Ando. The window had been open and the curtain half closed when he visited eight days ago, but he could distinctly remember closing the window and pulling the curtain to the side before he left. He knew he hadn’t left that window open. But there was something that bothered him even more. There was no wind to speak of on this early-winter evening. And yet the curtain had been blown beyond the railing until it was nearly horizontal. Where was that current of air coming from? He couldn’t hear any wind. The leaves of the trees lining the street weren’t moving. And yet, just above those motionless branches, the curtain danced. The scene was eerily off-kilter. But none of the passersby so much as glanced upward; nobody seemed to notice the odd phenomenon.

The only explanation Ando could think of was a mechanical one. Perhaps a powerful fan was blowing in the room, creating an artificial current flowing outward. But why? His curiosity was aroused.

He went around to the lobby. The only way he’d be able to find out would be to confront that room again.

The superintendent seemed to have the day off. The curtain was drawn at the counter of his office. The whole building felt quiet, with no signs anybody was about.

He took the elevator to the third floor and then walked toward room 303. The closer he got, the smaller and slower his steps became. His instincts were telling him to turn back, but he just had to know. The door to the outside hallway was open, and beyond it he could see a spiral staircase for emergency use. If something happens, maybe I shouldn’t use the elevator. Maybe I should just run down the stairs… Without knowing what exactly he was afraid of, Ando found himself planning an escape route.

He came to the door marked 303. Below the doorbell was a red sticker on which was written TAKANO. Everything was just as before. Ando went to ring the bell, but then thought better of it. Checking to see that the hall was deserted, he put his ear to the door. He couldn’t detect a sound, certainly not the motor of an electric fan. He wondered if the lace curtain was still waving outside the window at this very moment. From what he heard beyond the door, he had a hard time believing it was.

“Mai.”

Instead of ringing the bell, he called her name, gently, and knocked. No answer.

Mai watched the video, he reminded himself. And she, or someone, had taped over it, only two days before Ando’s visit. The fifth day of her disappearance. Who had done it, and why?

Suddenly, Ando could feel again on his skin the strange atmosphere of the room, like the inside of a body. The water at the bottom of the tub, the dripping, the feeling of something brushing against his Achilles tendon.

Ando backed away from the door. In any case, all four copies of that demon video had been wiped from the face of the earth. The crisis was over. No doubt Mai’s body would be found soon. No amount of screwing around here was going to bring him any closer to turning things around, Ando told himself as he started back toward the elevator. He was eager to get out of this place again, even at the expense of leaving without an explanation. He wasn’t sure why, but he seemed to feel like this every time he came here.

He pushed the elevator call button. While he waited, he kept repeating to himself, mutation, mutation. He wanted to keep his mind on something else, anything. The elevator was taking forever.

From the hallway to his right he heard a resounding snap as a dead-bolt clicked. Ando’s body stiffened. Instead of spinning completely around to look, he turned his head just far enough to see out of the corner of his eye. He saw the door to room 303 open slowly outward. He could see the red sticker: there was no doubt which door it was. Unconsciously, Ando pressed the elevator button again and again. The elevator was spending an agonizingly long time on the ground floor.

Seeing a figure emerge from the doorway, Ando braced himself. It was a woman in a summery green one-piece dress. She took a key from her handbag and locked the door, her face visible to Ando in profile. Ando studied the face. She was wearing sunglasses, but even so, it was clear to him that it wasn’t Mai. It was someone else. There was no reason for him to be afraid, but his body was running far ahead of his mind at this point.

The elevator doors opened and Ando slipped inside. He went to push CLOSE but accidentally pushed OPEN instead. Finally, a few beats late, the doors started to close. Then, at the last second, a white hand insinuated itself into the crack between the doors, which reacted by springing wide open again. The woman was standing there. Her sunglasses hid any expression her eyes might have had, but Ando could see that she was around twenty-five, with perfectly regular features. With one hand against the edge of the doors, she stepped smoothly onto the elevator and pressed the close button, and then the one for the ground floor. Ando inched nervously backwards until his back and elbows were pressed against the elevator wall and he was standing on tiptoe. From that position, he stared at this strange woman, this woman who had come out of apartment 303, and directed a single question at her from behind:

Who are you?

An odd smell, different from the scent of perfume, tickled his nose, and he made a face and held his breath. What could it be? It smelled like it contained iron, like blood. The woman’s hair reached down to the middle of her back, and her hand on the wall was so white it was almost transparent. A closer look revealed that the nail on her index finger was split. Her sleeveless dress was much too light for the season. She had to be freezing. On her legs she wore no stockings, and on her feet just a pair of pumps. He could see purplish bruises on her legs. This shocked him, but he didn’t know why. As hard as he tried, he couldn’t stifle the trembling that welled up from deep within him.

Shut up in that tiny box of an elevator alone with that woman, time seemed to drag for Ando. Finally they arrived at the ground floor, and Ando held his breath until the door opened. The woman walked straight across the lobby and disappeared into the street outside.

She looked to be about five feet tall, with a well-balanced figure. Her tight dress ended a few inches above the knees and showed off her derriere nicely, and she had a lithe walk. With no stockings to cover them, the backs of her legs showed up especially white, making the bruises on her calves stand out even more. The night was so cold that every other person on the street was wearing a coat, and yet off she went wearing nothing but a sleeveless summer dress.

Ando got off the elevator and then just stood there for a while, staring into the darkness after her.

6

Ando waited for Miyashita in front of the bank like he was told. It was a weekend evening, and the bank was closed. With its metal shutters down, the area in front of it looked curiously orderly. The darkness here was cozy, but as he waited for Miyashita to emerge from it, he couldn’t rid his mind of the image of that woman from apartment 303.

He tried, but she was burned onto his retinas. The whole time he’d half-sleepwalked back to the station from Mai’s building, and then the whole way here to Tsurumi Station, he’d been seeing her in his mind.

Who was she?

The most sensible explanation that occurred to him was that Mai’s sister had gotten concerned about her sibling and come to check on her apartment. Ando himself had called Mai’s mother and told her in simple terms what he’d found. If Mai did have a sister, and if she too lived in Tokyo, there wasn’t anything in the least strange about running into her at Mai’s apartment.

But there was something in the indescribable aura that the woman had exuded that negated such an easy answer. Riding in the same elevator with her had shaken Ando to the depths of his soul. She didn’t seem to be of this world, and yet, she didn’t look like a ghost, either. She’d definitely been there with him in the flesh. But Ando thought he would have had an easier time accepting her if she had been a ghost.

He saw a bead of light emerge from behind a mixed-occupancy office building and head straight for him.

“Hey, Ando!”

Ando squinted toward the light, and realized it was Miyashita, hurtling toward him on a small ladies’ bike, complete with shopping basket. He must have borrowed his wife’s bicycle.

With a squeal of brakes, he came to a stop in front of Ando. At first, Miyashita was too out of breath to speak. He just stood there, straddling the bike, elbows on the handlebars, head bobbing up and down as he gasped for air. Ando never thought he’d see Miyashita on a bike. The slightest exertion usually left him panting.

“That was quick.” Ando thought he’d be waiting for at least ten minutes. Miyashita was never early for anything.

Having parked the bike on the sidewalk in front of the station, Miyashita put a hand on Ando’s back and guided him into an alley where every building seemed to have a red lantern hanging from its eaves. His breathing had finally calmed a bit, and as they walked, he spoke to Ando.

“I think I know what ‘mutation’ might mean.”

That explained why Miyashita had come on a bike. He was dying to tell Ando his ideas.

“What does it mean?”

“Let’s have a beer first.”

As they ducked under a shop curtain, Ando noticed that it said Beef Tongue. Miyashita didn’t trouble to ask what Ando wanted; instead, the moment they were inside he called for two draft beers and an order of salted tongue. Miyashita seemed to know the proprietor. They exchanged glances of recognition as Miyashita and Ando headed for two counter seats in the back. Those were the quietest seats in the house.

First, Miyashita asked Ando what he had done to figure out the code embedded in Ryuji’s virus. Ando took the printout from his briefcase and began to explain the steps he’d gone through. Miyashita nodded repeatedly. Before Ando was half finished, Miyashita seemed to be convinced of the soundness of his method.

“It looks like ‘mutation’ has to be the answer, alright. The proof of your approach is that it yields exactly one solution.” Miyashita patted Ando on the shoulder. “By the way, I’m sure you’ve noticed what all this is analogous to?”

“What do you mean?”

Miyashita took a crumpled sheet of paper from his pocket and unfolded it. It had something drawn on it. Whatever it was, it had been done roughly, merely to illustrate a spur-of-the-moment idea.

“Have a look at this,” Miyashita said, handing him the paper. Ando took it and flattened it out on the bar in front of him.

He understood immediately. It was an illustration of how the DNA double helix inside a cell replicates itself. The strands of the double helix are complementary: when the structure of one is determined, the other one is automatically determined, too. When a cell divides, the two strands separate, each one faithfully creating next-generation copies of the original. This process of copying a gene and passing it down from parent to child can be thought of as the basics of heredity.

This was, of course, elementary to Ando. “What about it?” he asked.

“Think for a minute about the mechanism behind the evolution of species.”

There was a lot that still wasn’t known about evolution. For example, the basic concepts of Kinji Imanishi’s theory differed from those of Neo-Darwinism, but it was impossible to determine, definitively, who was right. All in all, it was “let a hundred flowers bloom” in the world of evolutionary theory; everybody, qualified or not, weighed in with strongly held opinions. But even without decisive evidence to settle the question, Ando knew that recent developments in molecular biology had come close to showing that sudden genetic mutations were a driving force in evolution.

So he answered by saying, with some confidence, “It probably begins with genetic mutation.” He felt he could guess where the conversation was going.

“Right. Mutation is the trigger that moves evolution forward. So, how do mutations happen?” Miyashita took a long swig of his beer, and then pulled a ballpoint pen from his breast pocket. Before Ando had a chance to reply to his question, Miyashita was writing again on the illustration. The reason mutations occur. Ando tried to peer past his hand at the sketch.

“An error arises in the genetic code-some chance damage or displacement to the genes- and that error is copied and passed down. Thus, a mutation. Are you with me? This is the current thinking on the mechanism of mutation.”

Miyashita pointed at his diagram with his pen to emphasize his points, but this wasn’t anything that had to be explained to Ando. Genetic damage can be caused on purpose in a laboratory using X-rays or ultraviolet radiation. But, usually, mutations occur at random. The DNA sequence, which theoretically should be faithfully copied and transmitted to future generations, sometimes mutates due to a copying error, so to speak, and as enough of these mutations accumulate through replication, gradually a new species arises. A given mutation can be looked at as one small step toward evolution.

“Remember that analogy I mentioned, my friend?” Miyashita murmured. Finally it dawned on Ando what Miyashita was getting at. X was like Y. Now that Ando considered it, there was indeed a resemblance.

“You’re talking about duplicating videos, aren’t you?” Ando finally said.

“Don’t you think it’s basically the same thing?” Miyashita shoved two slices of tongue into his mouth and washed them down with beer.

Ando turned the paper over and spread it out on the counter, and then borrowed Miyashita’s pen and began to make a diagram of his own. He needed to take stock of the points of similarity. Even if it was something he thought he already knew inside out, he knew it often helped him to map a thing out on paper.

On the 26th of August, a videotape came into the world in Villa Log Cabin. On the twenty-ninth, four young people lodging in that same cabin erased part of the end of the tape-the part that said, Whoever watches this video must make a copy of it and show it to someone else within a week. The kids taped commercials over this section of the video. To the videotape, it was as if an unforeseen, random event had damaged its genetic sequence, the chain of images. An error was introduced. The tape, now containing the error, was then copied by Asakawa. Naturally, the error was copied as well. Thus far, the process was exactly like the one DNA uses to replicate itself. Not only that, but the erased section of the tape, the message, was meant to play a critical role in the tape’s ability to reproduce. In genetic terms, it was a regulator gene. Shock to a regulator gene can make it easier for mutation to occur. Had a trauma to the end of the tape caused the video to mutate?

Ando let the pen come to rest. “Hold on a second. We’re not talking about a living thing here.”

Miyashita didn’t miss a beat. It was as if he’d prepared his response ahead of time.

“If someone asked you to define life, what’s your answer?”

Life, in Ando’s view, basically boiled down to two things: the ability of an entity to reproduce itself, and its possession of a physical form. Taking a single cell as an example, it had DNA to oversee its self-reproduction, while it had protein to give it external shape. But a videotape? To be sure, it had a physical form-its plastic shell, usually black and rectangular. But it couldn’t be said to have the ability to reproduce itself.

“A video doesn’t have the ability to reproduce on its own.”

“So?” Miyashita sounded impatient now.

“So you’re saying it’s just like a virus…”

Ando felt like groaning. Viruses are a strange form of life: they lack the power to reproduce on their own. On that score, they actually fall somewhere between the animate and the inanimate. What a virus can do is burrow into the cells of another living creature and use them to help it reproduce. Just as the videotape in question had held its watchers in thrall by means of its threat to destroy them unless they copied it. The tape had used people in its reproductive process.

“But…” Ando felt compelled to object at this point. He wasn’t even sure what he wanted to deny. He just felt that if he didn’t, something catastrophic would happen.

“But all copies of the video have been neutralized.”

There shouldn’t be any more danger, in other words. Even if the videotape had been alive in the limited way a virus is, it was extinct now. All four specimens that had been introduced into the world had now been removed from it.

“You’re right. The videotape is extinct. But that’s the old strain.” The beads of sweat on Miyashita’s face grew larger with every swallow of beer he took.

“What do you mean, old?” asked Ando.

“The video mutated. Through copying, it evolved until a new strain emerged. It’s still lurking out there somewhere. And it’s taken a completely different form. That’s what I think, anyway.”

Ando could only stare open-mouthed. His mug was empty, but he wanted something stronger than beer now. He tried to order some shochu gin on the rocks, but his voice faltered and he couldn’t make himself heard to the bartender. Miyashita took over, holding up two fingers and calling out, “Shochu!” Two glasses of the liquor were set on the bar before them, and Ando immediately reached out and drank about a third of his in one gulp. Miyashita watched him out of the corner of his eyes, and then said: “If the videotape did mutate and evolve into a new form during the process of multiple copying, then it wouldn’t matter at all to the new species if the old one died out. Think about it. Ryuji went to all the trouble of manipulating a DNA sequence so he could talk to us from the world of the dead. I can’t think of any other explanation for why he’d send us the word ‘mutation’. Can you?”

Of course Ando couldn’t. How could he? He brought the liquor to his lips time and again, but intoxication seemed still a long way off. His head was distressingly clear.

It might be true. Ando found himself gradually leaning toward Miyashita’s viewpoint. Ryuji probably meant the word “mutation” as a warning. Ando could almost see Ryuji’s face as he sneered, You think you’re safe. You think it’s extinct. But you won’t get off that easy. It’s mutated, and a new version is rearing its head.

Ando was reminded of the AIDS virus. It was thought that several hundred years ago some preexisting virus mutated and became what is now known as the AIDS virus. The previous virus didn’t infect humans, and may well have been harmless. But through mutation, it took on the power to wreak havoc with the human immune system. What if the same thing happened with this videotape? Ando could only pray that the opposite happened, that a harmful thing was now innocuous. But the facts suggested otherwise. Far from becoming harmless, the mutated videotape had turned into something that killed anybody who watched it regardless of whether or not they made a copy of it. If that was any indication, the thing was getting even nastier. And with Ando unable to form any conclusions yet about Mai’s disappearance, that left Asakawa as the only anomaly.

“Why is Asakawa still alive?” Ando asked Miyashita the same thing he’d asked him the day before.

“That’s the question, isn’t it? He’s the only clue as to what that videotape has turned into.”

“Well, actually… there is one other person.”

Ando gave Miyashita a brief rundown on Mai: how the video had made its way through Ryuji to her, how there was evidence that she’d watched it, and how she’d been missing for nearly three weeks now.

“Which means there are two people who saw the tape and are still alive.”

“Asakawa’s still alive, although just barely. I’m not sure about Mai.”

“I hope she’s alive.”

“Why?”

“Well, why not? We’re better off with two clues than with one.”

He had a point. If Mai was still alive, they might be able to figure out what she and Asakawa had in common. It might give them an answer. But for his part, Ando just hoped she was safe.