Spiral

1

It was already fifteen minutes past the time they were supposed to meet. Ando started to fidget. He took out his planner and checked the schedule again.

There it was: Friday, November 9th, 6:00 pm, in front of the Moai statue at the west exit of Shibuya Station. Meet Mai for dinner. He hadn’t misremembered.

Ando inserted himself into the flow of passersby and made a brief circuit of the area. Each time he saw a woman of roughly Mai’s age he peered at her face, but none were hers. Half an hour had passed now. Thinking maybe she’d forgotten, Ando called Mai’s apartment from a pay phone. He let it ring six or seven times, fancying he could hear from the echoes how small her apartment was.

It’s really tiny, she’d said. Less than five mats!

Ten rings. Obviously, she wasn’t home. He brought the receiver away from his ear. No doubt something had happened to make her late. She was probably on her way. At least he hoped so, as he hung up.

His gaze kept stealing back to his watch. It had been almost an hour now.

At seven I’ll give up.

It had been so long since he’d dated that he didn’t even know if it was proper to wait any longer. Come to think of it, he’d never been stood up before. His wife had been pretty punctual when they were dating. He’d kept her waiting occasionally, but never she him.

He spent a while thinking back over various times he’d waited for people in the past, and as he did so, seven o’clock came and went. But Ando couldn’t make himself leave. He couldn’t give up while there was still some slight ray of hope. As he kept telling himself, Five more minutes.… All week long he’d been looking forward to this. He couldn’t give up now.

In the end, Ando waited in the Shibuya throng for an hour and thirty-three minutes, but Mai never appeared.

He entered the hotel lobby and headed straight for the front desk to ask where the farewell party was being held. Funakoshi’s send-off. Now that Mai had stood him up, he had no reason not to come. Plus, after standing in the chilly evening air in a throng of countless young people, he just couldn’t bear to go straight back to his empty apartment. Seeking some way to salvage the evening, he’d hit on the idea of showing up at the party after all. It wouldn’t hurt to kick up his heels with his friends for the first time in a while, he reasoned.

The organized-gathering part of the evening was just ending, and people were getting together in groups of threes and fives to hit the bars. This was how it always worked. The professors would go home after the main party, allowing the younger faculty to speak freely in their informal post-party binge sessions. Ando’s timing was perfect; he’d come just in time to join in on one of those sessions.

Miyashita was the first one to notice him. He came over and put a hand on Ando’s shoulder. “I thought you were out on a date?”

“Oh, she stood me up,” Ando forced himself to say cheerfully.

“Ah, sorry to hear that. Hey, come here a second.” Miyashita grabbed him by the cuff and led him over to the space by a door. He didn’t seem interested in pursuing Ando’s strikeout.

“What is it?” Something seemed fishy.

But before Miyashita could tell him anything, Professor Yasukawa from the Second Internal Medicine Unit walked by. Miyashita whispered, “You’ll come drinking with us, right?”

“That’s why I’m here.”

“Great. I’ll tell you later.”

And then Miyashita was off to make nice with Yasukawa. As organizer, he thanked the professor for attending. Miyashita smiled and joked, his jowly face glowing. Ando couldn’t but admire the way his friend managed to find favor with all the profs. If anybody else acted in such a way it would have come across as smarmy, but Miyashita knew how to carry it off.

Ando stayed by the door, waiting for Miyashita and Yasukawa’s conversation to end. In the interim, several familiar faces passed by, but none did more than offer a greeting. Nobody cared to stop and talk to Ando.

His circle of friends had narrowed considerably in the time since he’d lost his son to the sea. He bore not a smidgen of a grudge against those who’d distanced themselves from him, though. He knew that the fault lay with him. Right after it had happened, everybody had crowded around him to offer help and comfort, but Ando hadn’t been able to respond appropriately. Instead, he’d just dragged his misery around interminably, acting morose with his friends. “Cheer up,” they’d say, but how could he? Gradually, one by one, they’d deserted him. Before he knew it, Miyashita was the only one left. Miyashita always had a joke ready, no matter how melancholy Ando’s expression. Miyashita knew how to find something to laugh about in misfortune, no matter whose. The only times Ando could forget his sadness were when he was with Miyashita. By now, Ando could put his finger on what it was that set Miyashita apart from his other friends: while everyone else came to him to cheer him up, Miyashita had come to actually have fun. There was no more meaningless phrase in all of language than “Cheer up!” The only way to get someone to cheer up was to help them forget, and saying “cheer up” had quite the opposite effect, only reminding the person why he or she was depressed in the first place.

Ando knew quite well that he hadn’t worn a sunny expression once all year. He tried to imagine, objectively, how he must look from Mai’s perspective. Terribly gloomy, no doubt. No wonder she didn’t want to have dinner with him; he’d only depress her more.

The thought, in turn, depressed him. A year and a half ago he’d been full of confidence. The future had stretched out before him, wide open and full of promise. He had a loving wife and a darling son, a ritzy condo in South Aoyama, a BMW with a leather interior, and a position as chief administrator waiting for him down the road. But he realized now that everything had been in his wife’s name, or her father’s, and a simple twist of fate had made it all slip through his fingers.

Miyashita was still talking with Professor Yasukawa. At a loss for what to do, Ando let his gaze wander idly around the lobby until he noticed a row of three pay phones. He took out a phone card and went over to them, thinking to dial Mai’s number one last time. Cradling the receiver on his shoulder, he looked back over at Miyashita. If he lost track of his friend and missed out on the drinking session, he’d have come all the way in vain. Miyashita was in charge, here. As long as Ando stuck close to his friend, he wouldn’t be stranded.

He let it ring eight times, then hung up and looked casually at his watch. Almost nine o’clock. It was three hours past the time they’d agreed to meet, and Mai still wasn’t home.

I wonder where she went. He was beginning to worry about her.

Miyashita was bowing deeply to Yasukawa. Their conversation seemed to be over. As Miyashita moved away from the professor, Ando went and stood by Miyashita.

“Hey, sorry to keep you waiting.” His tone was informal, a 180 degree reversal from how he’d been speaking to Yasukawa.

“No problem.”

Miyashita took a scrap of paper out of his pocket and handed it to Ando.

“This is where we’re going. I think you know it-it’s over in the Third District. Would you do me a favor and go on ahead? I have to wrap things up here.” He waved and started away, but Ando touched his elbow.

“Hold on a second.”

“What?”

“What is it you want to tell me?” Miyashita’s tease had been bothering at him.

Miyashita licked his lips with his thick tongue. They’d served roast beef at the party, and he was enjoying the last drops of grease. His lips glistened red as he said, “I found something.”

“What?”

“A virus.”

“A virus?”

“I got a call this afternoon from Yokodai University. Remember the two kids they autopsied over there?”

“The ones who died in a car of simultaneous heart attacks?”

“Yeah. Well, the thing is, a virus was found in their damaged tissue-from both of them.”

“What kind of virus?”

Miyashita frowned and exhaled. “You’re not going to believe it, but it looks identical to the smallpox virus.”

Ando was speechless.

“Seki’s diagnosis was right on the money. All he had to do was look at the ulcerations on the pharynx, and he came up with smallpox.”

“This is unbelievable,” Ando muttered.

“You can say that now. But I have a feeling we’re going to find the same virus in Ryuji’s tissue sample. Then you’ll have no choice but to believe it.”

Miyashita’s complexion was even ruddier than usual due to the alcohol he’d consumed. It made him look vaguely happy about the whole thing. Maybe the appearance of an unknown virus was more exciting than frightening for a student of medicine.

But not for Ando. His mind had already raced ahead to wonder about Mai. The fact that she was not answering her phone bothered him no end. Her absence and the discovery of a virus that resembled smallpox seemed somehow connected. He had a bad feeling about where all of this was going.

Maybe what happened to Ryuji is happening to Mai. Maybe it’s already happened.

The hotel lobby was filled with the clamor of drunken knots of people. Somewhere in the hullabaloo he could hear an infant laughing. A baby here at this hour? Ando wondered, checking the couches. But he didn’t see any baby.

2

Wednesday, November 14th

Ando went to the main campus, to the philosophy department, to ask Mai’s professors if she’d been attending classes recently. But everyone he asked said the same thing: they hadn’t seen her for a week now. As one of the few female students in the department, she stood out like a flower. When she missed class she was conspicuous by her absence.

Ever since last Friday, Ando had been calling her place two or three times a day, but no one was ever there to pick up the phone. He couldn’t imagine her camping out at a boyfriend’s house that whole time, and now his inquiries at her department had only exacerbated his concern.

It occurred to him that she might have gone home, so he went to the registrar’s office. He explained the situation to the person on duty there and managed to get a look at her file. He discovered that her hometown was a place called Toyoda, in Iwata County, Shizuoka Prefecture. It was two or three hours from Tokyo if you took the bullet train. Ando wrote down her phone number, and then her address, too, just in case.

As soon as he got home from work that night he dialed the number. Mai’s mother answered. When Ando explained who and what he was, he heard a sharp intake of breath on the other end of the line. Mai’s mother was panicking upon learning that she was talking to someone from the med school at Mai’s university. Even a call from her department would have been alarming, but one from a residing doctor could only mean Mai had fallen seriously ill. Her mother was probably bracing herself for the bad news. Students at the university all got free medical examinations at the university hospital, so Mai wouldn’t have had to ask her mother before going in.

But Mai’s mother couldn’t figure out exactly why Ando had called. She was in touch with her daughter at least two or three times a month. True, she hadn’t spoken with Mai in three weeks now; when she’d called last week, Mai had happened to be out. But she couldn’t understand why a doctor from her daughter’s university would be calling her parents’ house just because he hadn’t seen her for a week. Ando could hear suspicion in the woman’s voice as she carefully probed his every remark.

“So, you say your daughter wasn’t at home when you called last week.” Ando knitted his brow. He’d hoped to find out she’d just gone home for the week. He’d prepared himself for that minor embarrassment, but now, his bit of optimism was gone. Mai hadn’t been around when her mother called the week before, either.

“I’m sure it’s nothing, doctor. We had a stretch last year, too, when we kept missing each other’s calls. We went almost two months without talking then!”

Ando felt antsy. He couldn’t explain the situation even if he wanted to. Just the day before, they’d found in Ryuji’s tissue sample the same virus that had shown up in the two Yokohama kids. They hadn’t been able to establish how the contagion was passed on, or by what route it had traveled. Depending on what they turned up, perhaps the truth had to be withheld from the media. He couldn’t let Mai’s mother know what was going on, either.

“Excuse me for asking, but does your daughter spend the night away from her apartment often?”

“No, I don’t think so,” her mother said firmly.

“Do you happen to remember exactly what day it was you called her last week?”

The woman thought for a moment, then said, “Tuesday.”

So she had already not been answering her phone on Tuesday. Today was Wednesday. Over a week…

“Is it possible that she’s traveling?”

“No, I don’t think so.”

Ando wondered how she could be so sure. “Why not?”

“Well, she has a part-time job as a tutor just to pay her daily expenses. She doesn’t want to be a burden on her parents, she says. I simply don’t believe she has enough money to travel.”

All of a sudden Ando was sure that Mai was in some terrible trouble. The Friday before, Mai had stood him up. It wasn’t as if he was difficult to get hold of. If she couldn’t make the date, all she had to do was give him a call the day before and tell him. But she hadn’t done that. And now, he felt sure he knew why. She couldn’t contact him. He recalled the Polaroids of Ryuji’s corpse. No matter how hard he tried, he couldn’t rid himself of the picture of Ryuji’s limbs splayed out in death. It was still branded on his brain.

“Would it be possible for you to come up to Tokyo tomorrow?” As he made the request, Ando bowed even though he was talking to her over the phone.

“I’m not sure I can get away on such short notice,” she sighed. Then she was silent. Ando supposed he couldn’t expect her to feel a proper sense of urgency when he hadn’t given her the facts of the situation. All the same, though, she seemed a little too unconcerned about the whole thing. Ando wanted to tell her just how easy it was to lose someone you loved. How you could hear her voice, turn around, and find her gone.

Mrs Takano broke the awkward silence. “If I did go to Tokyo, what exactly would you have me do? File a missing person report?”

“I’d at least like you to take a look at her apartment. I’ll accompany you. We can think about a missing person report after that.” But Ando didn’t really believe they’d have to do that. This was- unfortunately-not that kind of case.

“I just don’t know… Does it have to be tomorrow?”

She couldn’t make up her mind. What errand could she have that was important enough to keep her from possibly finding her daughter dead? Ando couldn’t coddle her along any longer.

“Alright, then. I’ll go over to her apartment alone tomorrow. I understand she lives in a small studio. Do you happen to know if the building has a superintendent?”

“Yes, it does. I met him when I helped her move in.”

“Well then, I’m sorry to impose, but could I get you to call him and tell him that Mitsuo Ando will be coming by tomorrow afternoon, between two and three, and that I’d like to take a look at Mai’s room, in his presence of course?”

“Well…”

“Please. I doubt he’ll give me the key if I just show up unannounced.”

“Alright. I’ll make the call and set it up.” “Thank you. I’ll call you if anything conies up.” Just as he was about to hang up, Mai’s mother started to say something. “Listen…” Ando waited for her to continue. “Say hello to Mai if you see her.”

She doesn’t understand. Ando didn’t know what to feel as he hung up.

3

Mai’s apartment was only a short train ride from the university, no transfer required. Ando passed through the gate, left the station, and started to search for her apartment, map in one hand and the planner where he’d written the address in the other. He spotted a little girl in an orange kimono walking down the sidewalk ahead of him with her parents. He was reminded today was the traditional 7-5-3 festival, a celebration for boys of three and five and girls of three and seven. As he overtook and passed the trio he glanced at the child’s face. She seemed a little big, her features too well-developed, for her to be just seven years old. But her festive attire was bright and cheery in the afternoon sunlight. Ando thought her incredibly cute as she wobbled down the street in her unfamiliar lacquer sandals, clutching her mother’s hand. Even after he’d passed them, Ando kept stealing glances back at the three, imagining that in fifteen years the girl would grow up to be as beautiful as Mai.

He eventually located a seven-story apartment building facing a shopping arcade, the address of which matched what he’d written down in his planner. The facade was nice, but even from the outside, he could tell that the units had to be pretty small. They’d kept the rent low by cramming as many tenants as possible onto the property.

He found the superintendent’s office in the lobby and pushed the buzzer. Through the window, he could see him emerge from an inner room. An older gentleman. He opened a small door in the window, and Ando gave his name.

“Oh, yes. Miss Takano’s mother told me you were coming.” Jangling a thick bundle of keys, he came out of the office.

“I appreciate this,” Ando said.

“No, I ought to thank you. I’m afraid things haven’t been going well lately with that girl.”

Ando didn’t know exactly what Mai’s mother had told the man, so he didn’t know how to respond to this, except to say, “I guess not,” and follow him.

On the way to the elevator, they passed a bank of mailboxes. From one of them protruded several newspapers. Guessing it was Mai’s box, Ando had a closer look. As he’d suspected, the nameplate read TAKANO. There were four rows of mailboxes, and hers was in the top row.

“That’s Miss Takano’s. It’s hardly ever like that.”

Ando took the newspapers from where they’d been wedged into the mail slot and checked the dates. The oldest one was the morning edition from Thursday, November 8th. This was the seventh day since. It had been a full week, then, since Mai had last come down to pick up her newspaper. She could be sleeping somewhere else, but he doubted it. She was in her room, alright. It’s just that she couldn’t come down for the paper. All signs pointed in that direction.

The super interrupted Ando’s thoughts. “Okay, then, are you ready?” He sounded as if he thought Ando would back out.

“Yes, let’s go.” Plucking up all the courage he could muster, Ando followed the man into the elevator.

Mai’s apartment was on the third floor, room 303. The super took out his bundle of keys, chose one, and inserted it into the keyhole.

Without realizing it, Ando took a step back. I should have brought surgical gloves. The virus that had brought about Ryuji’s death was probably not airborne. He imagined it to be like AIDS, fairly difficult to catch. Still, it was an unknown quantity, and he should have taken precautions. Not that he was all that attached to life, but he didn’t want to die just yet. At least not until he’d figured out this puzzle.

A click echoed in the hall as the lock sprang open. Ando took another step backwards, but focused his sense of smell on whatever lay beyond the door. He was well-acquainted with the stench of death. It was mid-November, a fairly dry season, but he could expect a decomposing corpse to give off a powerful odor. He steeled himself until he was confident that even if the door opened to reveal what he expected it to, he could defend against the shock.

The door opened a few centimeters, and a gust of air blew out of the room and into the hallway. The window was probably open. Catching the wind full in the face, Ando breathed in, carefully, through his nostrils. He couldn’t detect the unmistakable scent of a dead body. He inhaled and exhaled several times. No smell of decay. His sense of relief was so strong that it threatened to knock him off his feet, and he put his hand against the wall to steady himself.

“After you,” urged the super, waiting in the doorway. Just standing in the entrance, he could see the whole interior of the apartment. There wasn’t really any “looking around” to be done. Mai’s body was nowhere to be seen. So Ando’s premonition had been an idle one; he relaxed and let out a deep sigh.

He took off his shoes and stepped past the super into the room.

“Where’s she gone?” grumbled the super from behind him.

Ando felt a strange sort of gloom steal over him. He should have felt relieved that he hadn’t found what he’d thought he’d find, but instead his heart continued to race. The room had a strange air about it, and he didn’t know why.

So she hasn’t been back here in a week. It was the only conclusion he could draw. Where is she now? He wondered if the answer to the new question he was left with awaited him somewhere in the room.

Directly next to the entrance there was a small bathroom. He opened the door a crack to make sure it was empty, then returned his gaze to the main room.

He could see how she’d tried to make efficient use of her limited space. A futon was neatly folded and stashed in a corner. There wasn’t enough space for a bed, nor was there a proper closet for the futon. Instead of a real desk there was a low table that had an electric space heater attached to its underside. The table was covered with manuscript pages. A discarded page had been folded up to serve as a coaster for a coffee cup, which was a quarter full of milk. Bookshelves covered one wall, and a combination TV/VCR was nestled in among the books. All the other appliances were arranged around the room almost as if they’d been built in, suggesting the care she’d put into choosing what to buy for her tiny apartment.

In front of the table sat an adjustable backrest that rocked unstably. It was covered with a penguin-print cloth. Pajamas, neatly folded, lay on the seat, with a bra and panties wadded up next to them.

Maybe it’s just because I’m in a young woman’s apartment? Ando was trying to figure out why he felt so uncomfortable. His chest was tight and his pulse was pounding. Seeing her underwear made him wonder if he was just an overexcited voyeur.

“What do you think, Doctor?”

The super was still standing in the doorway. He made no move to enter; he hadn’t even taken off his shoes. Since she clearly wasn’t to be found in her room, he seemed to have concluded that their business was finished and that it was time to go.

Ando didn’t reply, walking over to the kitchenette instead. The floor here was wooden, but for some reason it felt like a thick carpet. He looked up: a ten-watt fluorescent light had been left on. He hadn’t noticed it before because of the afternoon sunlight streaming in. Two glasses were in the sink. He turned the tap on, and after a while the water heated up. He pulled the string dangling from the bulb, turning out the light, and walked away from the kitchenette. When the light went out, he felt gooseflesh rising all over his body.

Nothing he saw gave him any clue as to Mai’s whereabouts.

“Shall we go?” Ando said, not looking at the super. He put his shoes back on and left the apartment. He heard the key turn behind him. He finished tying his shoelaces, straightened up, and walked to the elevator ahead of the super.

As they stood there waiting for the elevator, an autopsy Ando had performed the previous summer came back to him all of a sudden. It was on a young female who’d been strangled at home in her apartment. They’d told him she’d been dead for eleven hours, but when he cut her open he found to his surprise that her organs were still at something close to normal body temperature. When a person dies, the body temperature drops at an average of one degree Celsius per hour. Of course, that’s just an average, subject to all sorts of factors, such as the weather and location. All the same, it was extremely unusual to find a body still perfectly warm after eleven hours.

The elevator came up to the third floor and the doors started to open before Ando’s eyes.

“Hold on a minute,” he said. He didn’t want to leave while any doubts lingered. The oppressive feeling he’d gotten as he’d stepped into Mai’s room, the weird sensation of the wooden floor as he walked on it, almost as if it were melting away.

There was only one way he could describe the odd atmosphere of that room. It was like cutting into a body that had been dead for eleven hours and finding its insides still warm.

The elevator doors were fully open, but Ando did not step in. He was blocking the way, so the super couldn’t get in either.

“Aren’t you going to get in?”

Ando answered with a question of his own. “Are you sure you haven’t seen her at all this last week?”

The elevator shut its doors and began its descent to the ground floor.

“If I have, then we wouldn’t be here, would we?”

The super hadn’t seen her. She hadn’t shown up for class for a week, despite a near-perfect attendance record until now. She didn’t answer the phone no matter how many times he called. A week’s worth of newspapers were stuffed in her mailbox. It was clear that she’d been away since last Thursday. And yet, there was something about that place… It didn’t feel like an apartment whose occupant had been away for a week. There was warmth there, and it had nothing to do with the temperature of the room. It was just that something in the air said someone had been there until just a moment ago.

“I want to have another look,” Ando said, turning to the super, who looked first surprised, then troubled, and then, briefly, afraid. This last emotion did not escape Ando’s notice.

The old man’s afraid of something.

The super handed Ando the key ring, saying, “Just drop them off in the office when you’re done.” He gave Ando a look as if to say, If you want to go back, be my guest, but count me out.

Ando wanted to ask the super what his impressions of the place had been. But he’d probably be at a loss for words, even if Ando asked. That kind of thing wasn’t easy to express. Ando wasn’t sure if he himself could explain what he’d felt there.

“Thanks, I will,” Ando said, accepting the keys and turning on his heel. He was afraid that he’d lose his nerve if he hesitated. In any case, he made up his mind to get out of there as soon as he figured out why the place felt so weird.

Once again, he opened the door. He wished he could leave it open while he was in the apartment, but it swung shut automatically when he let go. The moment it shut, air stopped flowing through the room.

Ando took off his shoes again and walked to the window. He closed it and opened the lace curtains as wide as they’d go. It was past three in the afternoon, and the window faced south; rays of sun slanted into the room. Bathed in light, Ando turned to have another look. The decor didn’t strike him as particularly feminine, though it certainly wasn’t masculine. If it hadn’t been for the penguin design on the backrest, he wouldn’t have been able to guess the inhabitant’s gender.

Ando seated himself next to the backrest and picked up Mai’s underwear. He brought them close to his face and sniffed them, then held them away, then sniffed them again. They smelled like milk. Takanori’s undershirts had smelled like that when he was a toddler.

Ando put the underwear back where he’d found it and twisted his body until his eyes came to rest on the television. The power light glowed red: the VCR had been left on. He pushed EJECT and a tape popped out. There was a white label on its spine, with a title on it.

Liza Minnelli, Frank Sinatra, Sammy Davis, Jr/1989.

This was written in large letters, none too neatly, with a felt-tip pen. It didn’t look like a woman’s writing. He took the tape out and examined it. It was fully rewound. After he’d scrutinized it for a while, he slid it back into the VCR. Ando hadn’t forgotten how this whole series of incidents had something to do with a video. There was the story Mai had told him about Asakawa, then the fact that Asakawa had been carrying a video deck on the passenger seat at the time of the accident.

Ando pressed PLAY.

For two or three seconds the image on the screen looked like ink being mixed with some viscous fluid. Then a point of light appeared amidst the roiling blackness. Flashing, it moved around to the left and right, and then finally started to grow. Ando felt a momentary, but distinct, unpleasantness. Then, just when the point of light looked like it was about to turn into something else, a TV commercial came on. He recognized it as one he’d seen several times already. The contrast, as the darkness gave way to sunny ordinariness, was stunning. Ando felt his shoulder muscles unclench.

The ad was followed by another, and yet another. He fast-forwarded through more of them. Then came a weather report. A smiling woman was pointing to a weather map. He fast-forwarded some more, and got to what looked like a morning talk show. The scene changed again: a reporter was looking into the camera and speaking into a microphone, something about some celebrity getting divorced. Ando kept on fast-forwarding but couldn’t find anything that corresponded to the title on the label. The tape must have been recorded over.

As he watched, Ando began to relax. Of course, he hadn’t been expecting to see American singers, but something altogether more horrifying. Aside from the first few seconds, however, his fears had been misplaced: all the tape contained was mundane TV programming. The talk show came to an end and was followed by a rerun of an old samurai adventure. Ando stopped the tape and rewound it. He wanted to examine the weather report segment.

He found the beginning of the forecast and pressed PLAY. The woman said, “And now here’s a look at the weather for Tuesday, November 13th.”

He pressed PAUSE and the image froze.

November 13th?

Today was the fifteenth. Which meant that this had been recorded the day before yesterday. But who’d been around to press RECORD?

Was Mai here just two mornings ago?

But then how to explain the newspapers in her mailbox? Had she simply forgotten to pick them up?

Or maybe … He opened the front panel of the VCR and tried to see if there was any evidence it had been programmed. It was possible that when she’d left the room a week ago, Mai had set the VCR to record something on the morning of the thirteenth.

At that moment, he heard something. It sounded like the faint splash of a drop of water. Without getting up, he turned his torso until he could see the sink in the kitchenette. But there didn’t seem to be a drip there. He got up and peered into the bathroom.

The door was open a crack, just as it had been the last time he checked. He turned on the light and tried to push open the door. But it would only open halfway; the toilet blocked it. Ando leaned in through the narrow opening and saw a bathtub just large enough for someone to sit in if she drew her knees up to her chin. A nylon curtain draped down into it. He pulled the curtain out of the way and looked inside. Water dripped from the ceiling, landing with a splat; there was water pooled in the bottom of the tub. While Ando gawked, another drop fell, rippling the surface of the water. It was about four inches deep, and in one end of the tub it was swirling gently. Several strands of hair floated on the surface, and a few of them had gotten tangled as they swirled.

Ando wedged his way into the bathroom, leaning down until his head was inside the tub. The drain was a round black hole, that is to say, the plug had been pulled. Ando didn’t immediately realize what that meant. The drainpipes were clogged with soap, or hair, or something, and the water wasn’t draining well. But as Ando stared, he could see that the level was falling, if only gradually.

It finally occurred to Ando to ask himself who had pulled the plug.

It clearly hadn’t been the super. He hadn’t taken one step into the room. He hadn’t even taken off his shoes.

Then who?

Ando took another step into the bathroom and crouched down. He held out his hand and hesitantly touched the surface of the water. It was still slightly warm. A few strands of hair tangled themselves around his fingers. It felt just like… sticking his hands into an eleven-hour-old corpse and finding it had maintained body temperature. The apartment had supposedly been vacant for a week. But only an hour ago, someone had filled the tub with hot water and, even more recently, pulled the plug. It was for ventilation that the window had been left open.

Ando hurriedly pulled his hand back and wiped it on his trousers.

On the other side of the toilet, directly below the toilet paper, he noticed a brownish stain. It wasn’t fecal matter, but rather, like something that had been vomited up. Covered in a thin film, it retained the outline of undigested food. A reddish, square object-perhaps a piece of carrot?

Did Mai vomit this?

Ando was squatting with one foot in the tiny bathroom, but in order to examine the vomit he had to lean over. When he did so, though, he lost his balance.

He came to rest with his face pressed up against the edge of the toilet. The cream-colored porcelain digged coolly into his cheek, and he could only imagine what kind of expression he was making.

At that moment, he thought he heard someone laugh behind him.

Ando fought back the urge to scream, and froze in that ungainly posture.

It wasn’t his imagination. He’d heard a distinct giggle behind him, from a point rather low to the floor. As if it had welled up from the floor, like some plant shoot poking up from the ground, blossoming forth in laughter. Ando tensed his muscles and held his breath.

“Hee-hee.” There! The same giggle. He wasn’t hallucinating. He was absolutely certain someone was behind him. But he could hardly move, much less turn around and look. He couldn’t figure out what to do. With his face still pressed up against the smooth porcelain, he managed to call out, rather stupidly, “Is that you, super?” He couldn’t prevent his voice from trembling. One foot still sticking out of the bathroom door, he thought he felt a current of air on it. Something was moving out there. Now, that something touched him on the patch of exposed skin between the hem of his slacks and the top of his socks, where they’d scrunched down. It brushed against him as it moved past, leaving behind the memory of its slithery touch. The lower half of his body shrank from it, and he let out a cry. He tried to tell himself that it was nothing; maybe a cat that’d been trapped in the room had licked his Achilles tendon. Nothing more. But it didn’t work. Every one of his five senses knew that it was something else. Some unknown thing was behind him.

His face was below the top of the bathtub, so he couldn’t see inside, but he could hear the water inside trying to gurgle out. There was a faint slurping sound as the water swirled down the drain, hair and all. But above that sound, he heard the floorboards creak. The creaky noise receded slowly from him.

He couldn’t stand it any longer. He raised his voice in an inchoate yell, banged the bathroom door with his knee repeatedly, and even flushed the toilet. All the racket he’d caused finally gave him the courage to creep to his feet. Using his hands to steady himself, he raised himself until he was almost fully upright, and then he stopped to listen behind him. He desperately tried to think of a way to step out of the room without turning around. The hair on the nape of his neck stood on end, as if countless tiny spiders were crawling up his back.

He inched backward towards the entrance, making sure that his heel wasn’t touching anything, and then he whirled around, grabbed the doorknob, and stumbled out into the hallway. He banged his shoulder on the wall, but he ignored the pain as he watched the door swing shut.

Gasping for breath, Ando headed for the elevator. The super’s keys jangled in his pocket. Thank God he hadn’t left them in the apartment! He certainly didn’t want to go back in there again. He was sure something was in there, even though he could recall every corner of that room and he couldn’t think of a single place for anything to hide. The futon was folded up neatly. The built-in wardrobe was neither wide nor deep enough. There was no place for any living thing to hide- unless it was pretty small.

An out-of-season mosquito buzzed in his ear. He tried to swat it away, but it kept right on droning about him. Ando coughed weakly and jammed his hands into his pockets. Suddenly he felt cold. The elevator was taking forever to arrive. Finally, frustrated, he looked up, only to see that it was still on the first floor. He’d forgotten to push the button. He pressed it two or three times, just to be sure, and put his hand back in his pocket.

4

“Hey, what’s up?”

Ando didn’t realize he’d been drifting away until Miyashita spoke to him. The sensations of two hours ago had become a tidal wave, threatening to rip his consciousness out by the roots. He resisted frantically, and got gooseflesh for his efforts. Miyashita’s fervent monologue reached his brain only intermittently.

“Are you even listening to me?” Miyashita sounded annoyed.

“Yeah, I’m listening,” Ando replied, but his expression said his mind was elsewhere.

“If there’s something eating at you, maybe you ought to tell me about it.”

Miyashita pulled a stool out from under the table, plopped his feet onto it, and leaned back. He was a visitor in Ando’s office, but he acted as if the place were his own.

Ando and Miyashita were the only ones in the forensic medicine lab at the moment. Despite how dark it was getting outside, it was still not quite six in the evening. After his harrowing experience at Mai’s apartment, Ando had come directly back to the office to meet Miyashita. As a result, he hadn’t had any time to regain his equilibrium. And Miyashita had been telling him about the virus the whole time.

“No, nothing’s bothering me.” He had no intention of telling Miyashita what he’d experienced in Mai’s apartment. He had no words to express it, first of all. He couldn’t think of an appropriate metaphor. Should he compare it to that feeling you sometimes get, standing at the toilet in the middle of the night, that there’s someone behind you? The one where, once you’ve sensed them, the monsters in your imagination just keep growing and growing until you finally turn around and dispel the illusion? But what Ando had experienced was no such run-of-the-mill affair. He was sure there’d been something behind him when he lost his balance in Mai’s bathroom and hit his cheek against the toilet. It wasn’t a product of his imagination. Something had emitted that high-pitched laughter. Something that had made Ando, not normally a coward, too scared even to turn around.

“You look pale, though. Paler than normal, that is,” said Miyashita, wiping his glasses on his lab coat.

“I haven’t been sleeping well lately, that’s all.” It wasn’t a lie. Recently, he’d been waking up in the middle of the night and having trouble getting back to sleep.

“Well, never mind. Just don’t keep asking me the same questions over and over. No one likes to be interrupted.”

“Sorry.”

“Now. May I go on?”

“Please do.”

“About that virus they discovered in those bodies in Yokohama…”

“The one that’s just like smallpox,” Ando volunteered.

“That’s the one.”

“So it resembles smallpox visually?”

Miyashita slapped the tabletop. He flashed Ando a look of exasperation. “So you really weren’t listening. I just told you: they ran the new virus through a DNA sequencer in order to analyze its bases. Then they ran it through a computer. Turns out it corresponds closely to the library data on smallpox.”

“But they’re not identical?”

“No. We’re talking maybe a seventy percent overlap.”

“What about the other thirty percent?”

“Brace yourself. It’s identical to the basal sequence of an enzyme-encoding gene.”

“Enzymes? Of what species?”

“Homo sapiens.”

“You’re kidding.”

“I understand it’s pretty unbelievable. But it’s true. Another specimen of the same virus contained human protein genes. In other words, this new virus is made of smallpox genes and human genes.”

Smallpox was supposedly a DNA virus. If it were a retrovirus, then it would be no surprise to find it had taken human genes into itself. Such a virus would have reverse transcription enzymes. But since DNA viruses didn’t have them, how did this one pick up human genes and incorporate them into itself? Ando couldn’t think of any process. And with one virus containing enzymes and another proteins, it meant that together they contained human genes, but in separate components. It was as if the human body had been broken down into hundreds of thousands of parts, and those parts apportioned out individual specimens of a virus for safekeeping.

“Is the virus from Ryuji’s body the same?”

“Finally, we come to that. Just the other day, we found a nearly identical virus in a frozen sample of Ryuji’s blood.”

“Another smallpox-human combo?”

“I said ‘nearly’.”

“Okay.”

“It’s almost identical. But in one segment, we found a repetition of the same basal sequence.”

Ando waited for Miyashita to continue, and he did.

“No matter where we cut it, we kept coming up with a repetition of the same forty-odd bases.”

Ando didn’t know what to make of it.

“Are you following me? They didn’t find this in the two bodies in Yokohama.”

“So you’re saying that the virus found in their bodies is subtly different from the one that killed Ryuji?”

“That’s right. They look alike, but they’re slightly different. Of course, we really can’t say much until we get data from the other universities.”

At that moment a phone rang two desks over. Miyashita cursed under his breath. “What now?”

“Excuse me a minute, okay?” Ando leaned over and picked up the receiver. “Hello?”

“I’m Yoshino from the Daily News. I’m calling for a Dr Ando.”

“That’s me.”

Yoshino wasn’t quite satisfied. “Are you Dr Ando the lecturer in forensic medicine?”

“Yes, yes.”

“I understand you performed an autopsy on a Ryuji Takayama at the Tokyo Medical Examiner’s Office on the twentieth last month. Is that correct?”

“That’s right, I was in charge of that one.”

“I see. Well, I’d like to ask you a few questions about that, if I may. Can we meet?”

“Hmm.” While Ando deliberated, Miyashita leaned over and whispered in his ear.

“Who is it?”

Ando covered the mouthpiece with his hand before answering. “A reporter from the Daily News.” Then he quickly brought the receiver back to his mouth and asked, “What is this about?”

“I’d like to ask your opinion regarding a certain series of incidents.”

The man’s phrasing took Ando by surprise. Had the media already caught a whiff, then? It seemed far too early for that. Even the various med schools in charge of the autopsies had only begun to discover a connection among the deaths of the last two weeks.

“What series of incidents do you mean?” Ando decided to play dumb to try to find out how much Yoshino knew.

“I mean the mysterious deaths of Ryuji Takayama, of Tomoko Oishi, Haruko Tsuji, Shuichi Iwata, and Takehiko Nomi-and of Shizu Asakawa and her daughter.”

Ando felt as if he’d been hit on the head with a board. Who’d leaked all that? He didn’t know what to say.

“So how about it, doctor? Think you have time to meet with me?”

Ando wracked his brain. Information always flowed downhill, so to speak, from those who had more of it to those who had less. If this reporter had more information about the case than Ando, then perhaps Ando should try to get it from him. There was no need for Ando to show all his cards. The thing to do was to find out what he needed without giving up his own secrets.

“Alright, let’s do it.”

“When would be best for you?”

Ando took out his planner and looked at his schedule. “I assume you’d like it to be as soon as possible. How about tomorrow? I’m free for two hours after noon.”

There was a pause as Yoshino checked his schedule.

“Okay, good. I’ll come to your office at noon sharp.”

They hung up nearly simultaneously.

“What was that all about?” Miyashita asked, tugging on Ando’s sleeve.

“It was a newspaper reporter.”

“What does he want?”

“He wants to meet me.”

“Why?”

“He said he wants to ask me some questions.”

“Hmmph,” sighed Miyashita, thinking.

“It sounds like he knows everything.”

“So what does that mean? A leak?”

“I guess I’ll have to ask him that when I see him tomorrow.”

“Well, don’t tell him anything.”

“I know.”

“Especially that it involves a virus.” “If he doesn’t know already, you mean.” Suddenly Ando remembered that Asakawa also worked for the company that published the Daily News. If he and Yoshino knew each other, maybe Yoshino was in pretty deep. Maybe tomorrow’s meeting would turn up some interesting information. Ando’s curiosity was piqued.

5

Yoshino kept reaching for his water glass. He’d pretend like he was going to pick it up, and then look at his wristwatch instead. He seemed to be worried about the time. Maybe he had another appointment right afterwards.

“Excuse me for a moment, will you?” Yoshino bowed and stood up from the table. Threading his way between the tables on the cafe terrace, he went over to the pay phone next to the cash register. As Yoshino flipped open his notepad and started punching buttons on the phone, Ando was finally able to stop for breath. He leaned back in his chair.

An hour ago, at exactly noon, Yoshino had shown up at his office at the university. Ando had taken him to a cafe in front of the station. Yoshino’s business card still lay before him on the tabletop.

Kenzo Yoshino. Daily News, Yokosuka Bureau.

What Yoshino had told him, Ando couldn’t believe. It had left his head spinning. Yoshino had come in, sat down, and launched into a monologue that did nothing but seed Ando’s mind with doubts. Now he’d gone off to call God knew who.

According to Yoshino, the whole thing had started on the night of August 29th, at a place called Villa Log Cabin, a property of the South Hakone Pacific Land resort, located where the Izu Peninsula met the mainland. A mixed-gender group of four young people who stayed a night in cabin B-4 had found a videotape recorded psychically by some woman. A videotape that killed anyone who watched it, exactly a week later. What the hell?

It sounded like nonsense no matter how many times Ando went over it in his head. “It’s probably something akin to psychic photography,” Yoshino had said, as if that explained it. Mentally projecting an image onto a videotape? That was out and out impossible. And yet… Suppose he told somebody about the numbers he’d found on the piece of newspaper that poked out of Ryuji’s belly? Or the strange vibes he’d felt in Mai’s apartment? Wouldn’t people think he was talking nonsense? There was just no equating what you’ve experienced yourself with what you’ve heard from someone else; one could never feel as real as the other. But Yoshino had been directly involved, and what he said was substantiated by Ando’s own experience, at least. He’d helped Asakawa and Takayama investigate the case. His words were not entirely lacking in persuasiveness.

“Sorry to keep you waiting,” Yoshino said, returning to his seat. He quickly wrote something in his notebook, then poked his bearded cheek with the tip of his pen. His beard looked wiry, and it was long and full, as if to compensate for the thinning at the top of his head. “Now, where was I?” He leaned forward, bringing his hirsute visage closer to Ando. He had a certain charisma that came through when he spoke.

“You were starting to tell me how Ryuji got involved.”

“Right. Now, if you don’t mind, what was your relationship with the late professor?”

“We were classmates in med school.”

“Okay, that’s what I’d heard.”

Ando interpreted the remark to mean that Yoshino had run a check on him before contacting him.

“By the way, Mr Yoshino, have you watched the tape yourself?” The question had been weighing on Ando’s mind for a while.

“You’ve got to be kidding,” Yoshino said, wide-eyed. “You’d have met me in the autopsy room then. No, I don’t have the guts.” He chuckled.

Of course, Ando had had a sneaking suspicion for some time now that a videotape was involved in these deaths. But never in his wildest dreams did he suspect the existence of a video that killed anybody who watched it in exactly a week’s time. He still couldn’t quite believe it. How could he? He couldn’t accept such a thing, short of watching the video himself. Even then, he’d probably only truly believe it a week later, at the moment death came for him.

Yoshino drank his now-cold coffee, taking his time. He must have gained a little leeway in his schedule, because his movements no longer signaled haste.

“So why is Asakawa still alive? He watched the tape, didn’t he?” There was a note of scorn in Ando’s voice. Asakawa might be catatonic, but he was still alive. That didn’t seem to square with Yoshino’s story.

“You’ve hit the nail on the head, there. That’s exactly what’s bothering me, too,” Yoshino said, leaning forward. “I suppose the best thing to do is to ask the man himself, but I tried that and it got me nowhere.” Yoshino too had visited the hospital in Shinagawa, and he too had failed to communicate with Asakawa.

Then Yoshino seemed to have an idea. “Maybe…” he trailed off portentously.

“Maybe what?”

“I think you know what I’m talking about. If we could just get our hands on it.”

“On what?!”

“Asakawa’s a reporter for our weekly news magazine.”

Ando had no idea what Yoshino was getting at. “I know.”

“Well, he mentioned to me that he was putting together a comprehensive report on all this. I mean, the whole reason he got interested, to begin with, was that he thought he was onto a scoop. He teamed up with Takayama, and the two of them rushed off to Atami, and then to Oshima Island, hoping they’d find clues to unlock the riddle of the videotape. I think they found something. And I’ll bet you anything that it’s all written up and stored on a floppy disk.” Yoshino turned his head, leaving Ando staring at his profile.

“Ah-ha.”

Yoshino faced Ando again, this time with a bitter expression. “I just don’t know where it is. I couldn’t find it in his apartment.” Having said this, he stared off into space.

Asakawa was hospitalized, and his wife and daughter were dead. The apartment was empty. Was Yoshino saying he’d broken in and searched it? “His apartment?”

“Yeah, well, the building manager’s an old softie. All I had to do was come up with a good excuse, and he let me right in with the master key.”

It was the same thing Ando himself had done just the other day, out of concern for Mai, so he knew he couldn’t criticize Yoshino’s behavior. The motives may have been different, but in the end, they had both done the same thing: they had ransacked apartments in their occupants’ absence.

Yoshino didn’t look ashamed in the least, only annoyed. “I searched every corner of that place. Didn’t find anything. Not his word processor, not the floppy disk.” Yoshino bounced his knee with nervous energy. Then he noticed and placed a hand on the knee, flashing Ando a rueful smile.

Ando was recalling the photos he’d been shown of the scene of Asakawa’s accident. He remembered the one that showed the interior of the car from the vantage point of the driver’s side window. The thing he understood to be a video deck sat on the passenger’s seat, wedged under the back of the seat where it had been pushed forward; on the floor on the passenger’s side lay what looked like a laptop. The pair of black objects had made a deep impression on Ando. And now they gave him an idea. He turned his head, desperately trying to think, pretending to watch the crowd flowing out of the station like a human tidal wave.

Ando realized he knew where to find the report that could explain everything. No doubt Yoshino had searched Asakawa’s apartment with great diligence, but the word processor and disk weren’t there at all. Yoshino didn’t know that Asakawa had brought them with him wherever he’d last been to, that they were in the car at the time of his accident.

Ando was now fairly confident he could get his hands on that disk, and he had no intention of sharing the information with Yoshino. He’d decide whether or not to tell the media only after he’d read Asakawa’s report. Right now, all he knew was that this smallpox-like virus had been found in all seven of the corpses in question. They weren’t ready yet to announce their findings in professional circles. In fact, they were only beginning to put together a research team consisting mainly of Shuwa and Yokodai people. If he went and let the media in on it at this stage, there was no telling what kind of panic they’d whip up. He had to proceed with utmost caution to make sure things didn’t get out of hand.

Yoshino spent the rest of their meeting lobbing predictable questions at Ando. What were the results of the autopsy? What did he determine was the cause of death? Was any part of Yoshino’s story suggestive in terms of the results of the autopsy? The reporter kept his face buried in his notebook as he went through his list.

Ando tried to answer each question as politely and as unobjectionably as he could. But all the while, his thoughts were lunging in another direction. He had to get his hands on that floppy disk right away. What did he need to do to make that happen?

6

The next day was Saturday. After finishing two autopsies, Ando took aside the young cop who was there as a witness and asked him what happened to cars that had been in accidents. If a car had been wrecked in an accident near the Oi exit of the Metropolitan Bayside Expressway, for instance, what was done with it?

“Well, first we’d inspect it.” He was a trusty-looking young man with glasses. Ando had seen him several times before, but this was the first time he’d spoken to him.

“Then what?”

“Then we’d return it to the owner.”

“What if it’s a rental?”

“We’d return it to the rentacar agency, of course.”

“Okay. There were three people aboard this car, a young couple and their daughter. They, ah, lived in a condo in Shinagawa, just the three of them. The wife and child died in the accident, and the husband is in critical condition. Now, what happens to the items that were in the car?”

“They’d be kept in temporary storage in the traffic division of the local precinct.”

“For an accident that happened at the Oi off-ramp of the Metropolitan Expressway, what’s the local precinct?”

“The exit?”

“Yeah, that’s right. Near the exit.”

“No, I mean, was it on the expressway or off it? They’re different jurisdictions.”

Ando thought back to the photos of the accident scene. He was certain it had happened on the expressway itself. He seemed to remember seeing the phrase “Tokyo Harbor Tunnel entrance” written in a file somewhere.

“It was definitely on the expressway.”

“Then it’d be the Metropolitan Expressway Traffic Patrol Unit.”

Ando had never heard the name before. “Where’s the headquarters?”

“Shintomi.”

“Alright. So the items would be stored there temporarily. What next?”

“They’d contact the family and have someone come and get the items.”

“Suppose, like I said, everybody in the family’s dead.”

“Even the siblings and parents of the man in the hospital?”

Ando knew nothing about Asakawa’s parents and siblings. Judging from the man’s age, there was a good chance that his parents were still alive. It raised the possibility that they were in possession of whatever was in the car. Asakawa and Ryuji had been classmates in high school. Since Ryuji’s parents lived in Sagami Ohno, Asakawa’s probably lived somewhere in that area, too. In any case, the first thing Ando should do was to look them up and contact them.

“I see. Thank you very much.”

Ando released the young cop and straightaway set about locating Asakawa’s parents.

He determined that they were both alive and living in the Kurihara section of the city of Zama, not far from Sagami Ohno. He placed a call and asked what had happened to the items from their son’s car. Asakawa’s father told him, in a strained voice, to call his eldest son, who lived in Kanda, in Tokyo. Kazuyuki, it turned out, was the youngest of three brothers: the oldest worked in the art book division of Shotoku, a major publisher, while the middle son was a junior high school Japanese teacher. Asakawa’s father said that he had in fact received a call from the police asking him to come down and pick up some items they were keeping at the station, but instead of going to get them himself, he’d told them to contact his son in Kanda. Kanda wasn’t too far from Shintomi, where the Metropolitan Expressway Traffic Patrol Unit had their headquarters, and Asakawa senior hadn’t felt like lugging a word processor and a VCR home at his age-he was over seventy. So he’d arranged with the police for his son to pick up the items.

Ando’s next move, then, was to contact Junichiro Asakawa, who lived with his wife in a Kanda condominium. When he finally managed to get in touch with him that evening, Ando came straight out and told him the situation, or most of it at least. He was afraid that if he aroused Junichiro’s suspicions by slapping together a lie or a clumsy cover-up, he might never get his hands on the disk. On the other hand, he couldn’t simply repeat the story Yoshino had told him. Ando didn’t believe most of it himself, and Junichiro would surely think he was crazy. So he abridged things as he saw fit, ending by emphasizing that there was a possibility that Asakawa had left behind a document that might shed some light on what was happening. Speaking on behalf of the Medical Examiner’s Office, he said he’d really like to get his hands on that document and wondered if he might be allowed to make a copy of it, please and thank you.

“I’m not sure there was anything like that in what I was given.” Junichiro didn’t sound entirely convinced. The way he spoke suggested that he hadn’t yet taken a good look at the items.

“Is there a word processor?”

“Yes. But I think it’s broken.”

“Was there a floppy disk inside it?”

“To be honest, I haven’t checked. I haven’t even taken it out of the cardboard box they handed it to me in.”

“Was there a video deck along with it?”

“Yes, but I threw it away. Was that the wrong thing to do?”

Ando’s breath caught in his throat. “You threw it away?”

“I can see why he’d be carrying around the word processor, because of his job, but why did he have a VCR with him?”

“Excuse me, but did you say you threw it away?”

“Yes. It was a total wreck. I’d arranged garbage pick-up for a TV the other day, so I had them take the VCR away at the same time. It was beyond repair. Anyway, I doubt Kazuyuki’ll mind.”

Ando had almost caught his two quarries, and now, at the last minute, one had eluded him. There’d been a good chance that the videotape that held the key to all this had been inside the VCR, and with luck he’d hoped to get his hands on both it and the floppy disk. He was kicking himself for not having contacted Junichiro sooner.

“Besides the VCR, there wouldn’t happen to have been a videotape, would there?” Ando said a little prayer as he asked.

“I don’t know. All I saw was the word processor, the VCR, and two black leather gym bags that probably belonged to Shizu and little Yoko. I haven’t opened them.”

Ando made sure Junichiro understood that he wanted to see them as soon as possible. “Would you mind if I paid you a visit?”

“That’s fine,” Junichiro agreed, surprisingly quickly.

“How about tomorrow?” Sunday.

“Let’s see. I’m playing golf with one of my writers, but I should be back by seven.”

“Well, then, seven it is.” Ando made a note of the time, and underlined it several times.

At just after seven o’clock on Sunday evening, Ando called at Junichiro’s condo in the Sarugaku section of Kanda. The neighborhood didn’t feel very residential. Junichiro’s building was surrounded by office blocks. The area was eerily quiet on Sunday evenings.

Ando rang the bell and heard a man’s voice from behind the door ask, “Who is it?”

“This is Ando. I called yesterday.”

The door opened immediately, and Ando was ushered inside. Junichiro was lounging around in a sweatsuit and his hair was wet; he must have just arrived home from golf and taken a shower. Somehow, from his voice on the phone, Ando had imagined him as a tall, nervous man, but in person Junichiro was heavyset and wore a genial expression. As Junichiro led the way into the apartment, Ando reflected that, of the three brothers, the eldest was an editor, the second a Japanese teacher, and the third a reporter for a major news organization. They’d all chosen fields that had them dealing with language, with writing, on a daily basis. Most likely, the eldest had been influential in this regard. Ando himself had been inspired to enter medicine by his older brother, who became a high school biology teacher.

Junichiro went to the closet in the hall and took out a cardboard box. The gym bags and the word processor had been stuffed into it.

“So. You’d like to take a look?” Junichiro sat down cross-legged on the floor and pushed the box in Ando’s direction.

“Thanks, I would.”

Ando first took out the word processor, jotting down the make and model. The machine’s shell seemed to have been rather severely damaged in the crash; the top wouldn’t open, and pressing the power button elicited no response. Standing it vertically on his knee, Ando noticed an eject button there on the side. It belonged to a slot, and peering into it he saw a blue floppy disk. He almost shouted for joy as he pressed the eject button. The machine produced a click that sounded to Ando like bingo! He took out the disk and held it on his palm for a moment, examining it back and front. The label hadn’t been affixed, so there was no title to be seen. But Ando knew immediately that this was what he’d been searching for. It had sounded right popping out of the slot.

He wanted to read the disk as soon as he could, and he said to Junichiro, “I’d like to check out what’s on here.”

“I’m afraid this machine isn’t compatible with mine.” Junichiro wouldn’t be able to use his word processor to open the files on the disk.

“In that case, would you mind if I borrowed the disk for two or three days?”

“It’s alright with me, but…”

“I’ll return it to you as soon as I’m done with it.”

“What’s on that disk, anyway?” Ando’s excitement had evidently communicated itself. Junichiro suddenly seemed curious.

Ando shook his head. “I don’t know, exactly.”

“Well, I’d like it back as soon as possible.” Now it appeared that Junichiro wanted to read it, too. Maybe his editorial instinct had been stirred.

Ando dropped the disk into his jacket pocket, and knew a sense of relief, but at the same time he was seized with a new desire. Those gym bags… He knew it was futile to hope, but he couldn’t rule out the possibility that the videotape was in one of them.

“Would it be too much to ask if I could see what’s in there?” He tried to choose his words carefully, somewhat embarrassed at the idea of going through a woman’s belongings.

“I don’t think there’s anything in there,” Junichiro laughed, but he handed over the bags. When he looked inside, Ando’s faint hope of finding the tape was finally dashed. Mostly the bags contained clothes and disposable diapers. Not what he was looking for. Just as he’d feared, the tape had been inside the VCR when it was trashed.

Still, he’d gotten his hands on the floppy disk, and he had to count that a success. He could hardly stand still as he took his leave. He’d check around at work to see if anybody had a machine that could read the disk. He couldn’t wait to see what was on it.

7

Ando poked his head into the Pathology Department office to see if Miyashita was in, but before he had a chance to say anything, Miyashita called out to him.

“Hey, just the man I wanted to see. Tell me what you think of this.” Miyashita was holding a printout of something, and he beckoned to Ando with his other hand. Beside him stood Nemoto, an assistant in the biochem lab. Nemoto and Miyashita were built so alike that anybody who happened to see them together couldn’t help but laugh. From their height and weight-five-three and easily over a hundred and seventy pounds- to the length of their legs, their girth, their faces, even their taste in clothes and their high voices, they were like two peas in a pod.

“Hey, I didn’t know you had a twin.” Ando uttered the same joke he always did as he approached them.

“Please, Dr Ando, don’t lump me together with this guy,” said Nemoto, grimacing. But it couldn’t have been too awful to be told he took after his colleague, two years his senior. After all, Miyashita was liked both for his personality and his learning, and had been pegged as a future candidate for full professor.

“Everybody keeps telling us we look alike, Nemoto. I’m telling you, it’s getting to be a pain in the butt. Why don’t you go on a diet?” Miyashita elbowed the younger man’s paunch.

“Well, if I go on a diet, you have to go on one, too.”

“Then we’ll be right back where we started!”

Then Miyashita offered Ando the printout he was holding, as if to put an end to the stale routine.

Ando spread out the printout he’d been given. He understood its contents at a glance. It showed the results of running a snippet of DNA through a sequencer.

All life on earth consists of one or more cells containing DNA (or, in some cases, RNA). The nuclei of these cells contain molecular compounds known as nucleic acids. There are two types of nucleic acids: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). These play different roles. DNA is the compound in which genetic information is stored in the chromosomes: it takes the form of two long threads twisted about one another in a spiral, a shape known as the double helix. The sum total of a life form’s genetic information is inscribed within that double structure. This genetic information is like a set of blueprints for the construction of specialized proteins; each gene is a blueprint. In other words, genes and DNA are not the same thing. A gene is a unit of information.

So what exactly is written on these blueprints? The letters that make up the inscriptions are four chemical compounds known as bases: adenine (A), guanine (G), cytosine (C), and thymine (T) or in the case of RNA, uracil (U). These four bases work in sets of three called codons, which are translated into amino acids. For example: the codon AAC makes asparagine, the codon GCA makes alanine, etc.

Proteins are conglomerations of hundreds of these amino acid molecules, of which there are twenty types. This means that the blueprint for one protein must contain an array of bases equal in number to the number of amino acid molecules times three.

The blueprint called the gene can be thought of, then, as basically a long line of letters, looking something like this: TCTCTATACCAGTTG-GAAAATTAT… Translated, this signifies a series of amino acids that runs: TCT (serine, or Ser), CTA (leusine, or Leu), TAC (tyrosine, Tyr), CAG (glutamine, Gln), TTG (leusine, Leu), GAA (glutamic acid, Glu), AAT (asparagine, Asn), TAT (tyrosine, Tyr), etc. etc.

Ando glanced again at the base codes covering the printout, the four letters A, T, G, and C lined up seemingly at random across the page. Segments of three rows had been highlighted so as to stand out from the rest.

“What’s this?”

Miyashita winked at Nemoto, as if to say, you tell him.

“This is an analysis of a segment of DNA taken from the virus found in Ryuji Takayama’s blood.”

“Okay… so what’s this?”

“We found a rather strange sequence of bases, something we’ve only seen in Takayama’s virus.”

“And that’s what’s highlighted here?”

“That is correct.”

Ando took a closer look at the first highlighted series of letters.

ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA

He looked at the next highlighted portion, and compared it with the first. He realized it was exactly the same sequence. In a group of not even a thousand bases, the exact same sequence occurred twice.

Above: between #535 and #576, and again between #815 and #856, one can observe the repetition of the 42 bases ATGGAAGAA-GAATATCGTTATATTCCTCCTCCTCAACAACAA.

Base triplets (codons) are translated into amino acids according to the principles outlined in the chart above. For example, TCT is serine (Ser), AAT is asparagine (Asn), GAA is glutamic acid (Glu). “Stop” signifies the end of a gene; the beginning code is ATG.

Below are the abbreviated and full names of the twenty amino acids:

Ando shifted his gaze from the printout to Nemoto’s face.

“No matter where we slice it, we always find this identical sequence.”

“How many of these are there?”

“Bases, you mean?”

“Yeah.”

“Forty-two.”

“Forty-two. So, fourteen codons, right? That’s not very many.”

“We think it means something,” Nemoto said, shaking his head. “But, Dr Ando, the strange thing is…”

Miyashita interrupted. “This meaningless repetition was only found in the virus collected from Ryuji Takayama’s blood, and not from the other two victims.” He threw up his hands in a gesture of perplexity.

In other words.… Ando tried to find a suitable analogy. Suppose three people, one being Ryuji, had copies of Shakespeare’s King Lear. Then suppose that Ryuji’s copy, and only his copy, had meaningless strings of letters sandwiched in between the lines. There were forty-two bases, and they worked in sets of three, each set corresponding to one amino acid. If you assigned each of these sets a letter, you’d have a series of fourteen letters. And these fourteen repeating letters were found on every page of the play, inserted at random. If you knew from the beginning that the play was King Lear, of course, it would be possible to go back and find the meaningless parts that had been interpolated and highlight them.

“So what do you think?” Miyashita looked to be sincerely interested in Ando’s opinion. A true scientist, he was always most excited when confronted with the inexplicable.

“What do I think? I’d have to know more before I could say anything.”

The three of them fell silent, glancing at one another’s faces. Ando felt awkward, still holding the printout.

Something was tugging at his consciousness. In order to figure out what it was, he needed time to sit down and study the meaningless string of bases. He had an unmistakable premonition that there was something here. The question was, what? And if this meaningless base sequence had indeed been interpolated, when had it happened? Was the virus that had invaded Ryuji’s body just different? Or had it mutated in Ryuji’s body, with the fourteen-codon string appearing here and there as a result of that mutation? Was that even possible? And if it was, what did it mean?

An oppressive silence fell over the three men. No amount of speculation at this point could tell them how to interpret these findings.

It was Miyashita who broke the silence. “By the way, did you come here for a reason?”

Ando had been so intrigued by the discovery that his original errand had slipped his mind. “Right, I almost forgot.” He opened up his briefcase, took out his planner, and showed Miyashita and Nemoto a slip of paper.

“I was wondering if anyone here had a word processor of this model.”

Miyashita and Nemoto looked at the model name written on the paper. It was a fairly common machine.

“Does it have to be exactly the same model?”

“As long as it’s the same brand, the model probably isn’t important. Basically, it’s a question of compatibility for a floppy disk.”

“Compatibility?”

“Yes.” Ando took a floppy disk from his briefcase.

“I need to make a hard copy and a soft copy of the files on this disk.”

“It’s not saved in MS-DOS, I take it?”

“I don’t think so.”

Nemoto clapped his hands, as if he’d just remembered something. “Hey, one of the staff members in my department-Ueda, I think-has this very model.”

“Do you suppose he’d let me borrow it?” Ando hesitated. He’d never met this Ueda.

“I don’t imagine there’d be a problem. He’s fresh out of school.” Nemoto spoke with the confidence of a senior staff member who knew that a new resident would do anything he asked.

“Thanks.”

“No problem at all. Why don’t we go over right now? I think he’s there.”

This was music to Ando’s ears. He couldn’t wait to print out whatever was on this disk.

“Great. Let’s go.” Ando dropped the disk back into his jacket pocket. Then, waving to Miyashita, he followed Nemoto out of the Pathology Department.

8

Ando and Nemoto walked side by side down the med school’s dim hallway. Ando wore his lab coat unfastened in front, its tails swept back behind him, with his hands in the pockets of his jacket clutching the disk. Neither Miyashita nor Nemoto had asked about it. Ando wasn’t trying to keep it a secret. Had Miyashita asked, he’d intended to give him an honest answer. If they’d known it might hold the key to this whole mystery, no doubt both men would have been at his heels right now.

Of course, Ando hadn’t seen what was on the disk yet. There was always the possibility that it held something else entirely. He simply wouldn’t know until he managed to bring it up on a monitor. Still, it felt right in his hand: the disk was warm from being in his pocket. It was near body temperature. Its touch seemed to tell him that it held living words.

Nemoto opened the door to the biochemistry lab. Ando took the disk out of his pocket, switched it to his left hand, and held the door open with his right.

“Hey, Ueda.” Nemoto beckoned to a skinny young man seated in a corner of the room.

“Yes?”

Ueda swiveled in his chair to face Nemoto, but didn’t stand up. Nemoto approached him, smiling, and put his hand on Ueda’s shoulder. “Are you using your word processor right now?”

“No, not really.”

“Great. Would you mind if Dr Ando here borrowed it for a while?”

Ueda looked up at Ando and then bowed. “Hello.”

“Sorry about this. I’ve got a disk I need to access and it’s not compatible with my machine.” Ando moved to Nemoto’s side, holding up the disk.

“Go right ahead,” said Ueda, picking up the word processor from where it sat on the floor at his feet and laying it sideways on the desktop.

“Do you mind if I check it right here just to make sure?”

“Not at all.”

He opened the word processor’s lid and turned it on. Soon the initial menu appeared on the screen. From among the options displayed, Ando chose DOCUMENTS, then inserted the disk. The next screen gave him two options: NEW DOCUMENT and OPEN DOCUMENT. Ando moved the cursor to the second option and hit return. With a whir, the machine started to read the disk. Finally, the names of the files stored on the disk appeared on the screen.

Ando read the file names aloud in a delirium. “Ring, ring, ring, ring…”

Ring!

What the hell? The same word that I got from solving the code that popped out of Ryuji’s belly.

“Are you alright?” Nemoto sounded worried. He was peering at Ando’s suddenly dazed expression. Ando could barely manage to nod.

There was no way this could be a coincidence. Asakawa had composed a report detailing this whole strange train of events, saved it in nine parts, and entitled it Ring. And then that title had extruded from Ryuji’s belly.

How to explain this? There is no way.

Ando was in a state of complete denial. Ryuji’s body was completely empty; he was like a tin man. Am I saying he slipped me a message from his abdominal cavity? That he was trying to tell me of the existence of these files?

Ando recalled the way Ryuji’s face had looked right after the autopsy. His square-jawed face had been smiling. Ando had expected that any minute he’d start laughing at him, stark naked on the table, jowls shaking.

Deep down, Ando could feel Yoshino’s outlandish story starting to take on the feel of reality. Maybe it was all true. Maybe there really was a videotape that killed you seven days after you watched it.

9

The word processor buzzed ceaselessly as it printed out page after page. Ando tore each page from the printer as it emerged and read through it quickly.

Each page was single-spaced, but still Ando was able to read faster than the printer could spit them out. Wanting a hard copy, he’d decided to print it all out instead of reading it on the screen. Now he found himself getting frustrated by the two or three minutes it took each page to be printed.

He’d ended up borrowing Ueda’s machine and bringing it home with him. A quick check had revealed that the total report was close to a hundred pages, more than he could reasonably print out there in the lab. He had no choice but to stay up late at home.

Now he was at the end of page twenty-one of the manuscript, alternating between reading it and taking bites of the dinner he’d picked up at the convenience store on the way home. What he’d read so far followed faithfully the outline Yoshino had given him the week before. But it differed from what Yoshino had told him after lunch at the cafe in that it contained specific times and places. As a result it was a good deal more persuasive. The reporterly style-no frills-also made it harder to disbelieve.

While investigating the simultaneous deaths by heart attack of four young people in Tokyo and Kanagawa prefecture on the evening of September 5 th, Asakawa had come up with the idea that the culprit was some kind of virus. Scientifically speaking, it was the obvious conclusion. And since autopsies on the four bodies had indeed revealed a virus that closely resembled smallpox, it turned out that Asakawa’s hunch had been right. It had been Asakawa’s guess that since the four had died at the same moment, they must have picked up the same virus together at the same place. He’d figured that the key to the whole case must lie in figuring out where they were exposed to the virus, that is, in determining the route of transmission. Asakawa had succeeded in finding out when and where the four had been together: August 29th, exactly a week before their deaths, at South Hakone Pacific Land, in a rented cabin, Villa Log Cabin No. B-4.

The next page, page twenty-two, started with Kazuyuki Asakawa himself heading toward the cabin in question. He took the bullet train to Atami, then rented a car and took the Atami-Kannami highway to the highland resort. Rain and darkness limited the visibility, and the mountain road was awful. He’d made reservations for cabin B-4 at noon, but it was past eight at night when he finally checked in. So this was where those four kids had spent the night: the thought gave Asakawa a jolt of fear. Exactly a week after they’d stayed in this cabin, they were dead. He knew it was possible that the same spectral hand would touch him, too. But he couldn’t overcome his reporterly curiosity and ended up searching B-4 from top to bottom.

From something the kids had written in a notebook on the property, Asakawa determined that they had watched a videotape that night, so he went to the manager’s office to search for that tape. He’d found an unlabelled, unboxed tape lying on the bottom shelf. Was this what he was looking for? With the manager’s permission, he took the tape back to cabin B-4, and, with no way of knowing what it contained, he inserted it into the VCR in the living room and watched it all the way through.

At first, everything was dark. Asakawa described the opening scene like this:

In the middle of the black screen a pinpoint of light began to flicker. It gradually expanded, jumping around to the left and right, before finally coming to rest on the left-hand side. Then it branched out, becoming a frayed bundle of lights, crawling around like worms…

Ando looked up from the page. Based on what he was reading, he was able to get a reasonably clear image of what had been on the screen. Reading Asakawa’s description of the opening, an image popped into his head that he felt he’d seen somewhere before. A firefly flitting around on a dark screen, growing gradually larger… then the point of light splays out like the fibers of a paintbrush. It was a short scene, but one that he could remember seeing, and recently at that.

It didn’t take long for the memory to come to him. It was when he’d gone to Mai’s apartment to try and track her down. He’d found a videotape still in her VCR, and he’d pressed the play button. The one with Frank Sinatra, Liza Minnelli, etc., written on the label in a man’s hand. The first few seconds of that tape had fit this description perfectly.

But on the tape in Mai’s apartment, this scene had only lasted a few seconds, before the screen suddenly became a lot brighter. In what had evidently been an attempt to erase whatever was on the tape, Mai had recorded morning variety shows, samurai melodrama reruns, whatever, until the tape ran out. Ando immediately figured out what this meant. Somehow, probably through Ryuji, Mai had acquired the problem tape and watched it in her apartment. Then, when she’d finished, she’d eradicated it, whatever it was, from the tape. She must have had her reasons. But she hadn’t been able to erase the very beginning of the tape, so those first few seconds had remained there, lurking. Did it mean that the tape Asakawa had found in Villa Log Cabin had somehow made its way into Mai’s hands?

Ando tried to organize his thoughts. No, that can’t be it. The tape Asakawa found and the tape Mai had were clearly two different things. According to the report, the one in the cabin was unlabelled. But the one in Mai’s VCR had a title written on it in black marker. Which meant it must have been a copy.

The one in the cabin was the original, and the one in Mai’s place a copy. So that tape had been copied, erased, disguised, transported-a dizzying series of changes. In Ando’s mind, the tape, occupying a point between the animate and the inanimate, began to resemble a virus.

So, was Mai’s disappearance a result of her having watched that tape? The possibility worried him. She hadn’t been back to her room since then. She hadn’t been showing up at school, and she hadn’t even called her mother. On the other hand, he hadn’t heard anything about a young woman found dead from unexplained causes.

Ando let his mind wander for a while, considering all the things that could have befallen her. Maybe she’d died alone someplace unbeknownst to anybody. The thought pained him-she was only twenty-two. The fact that he could feel the first twinges of a crush on her only made it harder to bear.

The printer finally came to the end of another page, with a noise that snapped Ando out of his reverie. In any case, now was no time to be borrowing trouble. At the moment, he’d be better off finding out what was on that tape first.

10

The next few pages contained a thorough description of the contents of the videotape. As he read, Ando could see a TV screen in his mind, filled with shifting images.

Something red and viscous spurted across the screen. This was followed by a view of a mountain that he could tell at a glance was an active volcano. Lava flowed from its mouth; the earth rumbled. The eruption lit up the night sky. Then this scene was suddenly cut off, replaced by a white background, in front of which the character for “mountain”, written in black, faded in and out of view. Then a scene of two dice bouncing around on the bottom of a bowl.

Finally a human figure appeared onscreen. A wrinkled old woman sat on a tatami mat. She was facing the camera and saying something. She spoke in a nearly incomprehensible dialect, but he could tell, more or less from the sound of her words, that she was predicting somebody’s future, warning him or her.

Next, a newborn baby, wailing. There was no discernible link between scenes. One followed another with all the abruptness and randomness of someone flipping over cards.

The infant disappeared, replaced by hundreds of faces, filling the screen and multiplying as if by cellular division, all against the background of a multitude of voices intoning accusations: Liar! Fraud! Then an old television set, displaying the character sada.

Then a man’s face appeared. He was gasping for breath and dripping with sweat. Behind him could be seen a lush thicket of trees. His eyes were red and full of bloodlust; his mouth was contorted with screams and drool. His bare shoulder was deeply gouged, and blood flowed from the wound. Then came again, from nowhere in particular, the cry of a baby. In the center of the screen was a full moon, from which fell fist-sized stones, landing with dull thuds.

Finally, more words appeared on the screen.

Those who have viewed these images are fated to die at this exact hour one week from now. If you do not wish to die, you must follow these instructions exactly…

And then the scene changed entirely. Instead of the prescribed method for avoiding certain death, the screen now showed a common television commercial for mosquito coils. The ad ended and the previous eerieness returned, or rather, the memory of it.

At the end of this series of bizarre visions, Asakawa had managed to understand exactly two things. First, whoever watched this tape was doomed to die in exactly a week. And, second, there was a way to avoid this fate, but it had been deliberately recorded over. The four kids who’d watched the video first had erased it in a fit of malice or mischief. It was all Asakawa could do to slip the tape into his bag and flee cabin B-4.

Ando took a deep breath and lay the manuscript aside.

Holy shit.

In his report Asakawa had given a painstakingly elaborate account of the strange twenty minutes of images on the tape. He’d made every effort to recreate, using only words, what the video conveyed directly through sound and visuals, and he’d largely succeeded. The scenes still swirled around in Ando’s mind, as vividly as if he’d seen and heard them himself. He sighed again, suddenly exhausted. Or maybe it wasn’t fatigue. Perhaps it was that he now felt Asakawa’s fear as his own, and wanted somehow to push it away.

But even a moment’s pause only whetted his desire to know more. Taking a sip of tea, he picked up the next page of the report, and started reading ahead, even faster than before.

The first thing Asakawa did upon returning to Tokyo was to call Ryuji Takayama and tell him what had happened. Asakawa had neither the time nor the courage to solve this thing alone. He needed a reliable partner, and so naturally his thoughts turned to Ryuji, whom he’d known since high school. He also approached Yoshino, but Yoshino refused to watch the video. Regardless of whether or not he actually believed in it, if there was even a slim chance that calamity would befall him as a result of watching the video, he wanted to avoid doing so.

But not Ryuji. As soon as he heard about this video that’d kill in a week’s time anyone who watched it, the first words out of his mouth were, First let’s have a look at this video.

So Ryuji watched the video in Asakawa’s apartment, fascinated. And when it was over he asked Asakawa to make him a copy.

The word “copy” made Ando sit up and take notice. Now he thought he could figure out the route the tape had traveled. The original tape from Villa Log Cabin had most likely stayed in Asakawa’s possession. It had been in the VCR in Asakawa’s car at the time of the wreck, had passed to Asakawa’s brother Junichiro, and been thrown away. There was one more tape, the one in Mai’s apartment, the one with only the very beginning remaining. This was probably the copy Asakawa had made for Ryuji that first night. It had a title on the label, written in thick letters in a man’s hand. It was probably Asakawa’s handwriting. When Ryuji had asked Asakawa to make him a copy, instead of using a brand-new tape, Asakawa had recycled an old tape on which he’d originally recorded a music program. This had passed through Ryuji’s hands into Mai’s. That much made sense. But when had Mai received it? Mai had never mentioned having the tape to Ando. Which meant, Ando supposed, that she’d come across it by chance, several days after Ryuji’s death, and watched it not knowing it was dangerous.

In any case, the tape had been replicated in Asakawa’s apartment. Ando felt he needed to keep that in mind.

So Ryuji took the copy of the tape back to his apartment and started working on figuring out the erased message (he and Asakawa called this “the charm”). Both men wondered what this weird recording was doing in Villa Log Cabin B-4. At first they thought that it had been shot with a video camera and then left there, but that turned out not to be the case. Three days before the unfortunate youths, a family had stayed in B-4, they’d put a tape in the VCR and set it to RECORD. They’d then forgotten about it and left it there when they went home. So the images on the tape had not been shot elsewhere and the tape brought to the cabin: rather, some sort of unknown transmission had been captured on the tape when the machine was recording. The next people on the scene had been the four young victims. With time on their hands, they’d decided to watch a video; when they went to turn on the VCR, out popped a tape. They’d watched it. The threat at the end must have amused them. Like we’re really going to die in a week if we don’t do what it says? So they decided to play a trick by erasing the solution; that should scare the next guests. Of course, the kids never really believed in the tape’s curse. If they had, they never could have pulled such a stunt. In any case, the tape was found the next day by the manager, who put it on the shelf in the office, where it stayed unnoticed by anyone until Asakawa’s arrival.

So how had those images gotten into the deck while it was recording? It occurred to Asakawa that some maniac might have hijacked the airwaves, so he tried to pinpoint the source of such a broadcast. Meanwhile, when Asakawa was out of the house his wife and daughter found the video still in the VCR and watched it. Now Asakawa was urged on by the desire to save not only his own life, but also those of his family.

Then Ryuji made a startling discovery. Watching the tape over and over at home, he had a flash of inspiration. He made a chart and found that the tape could be broken down into twelve scenes, which fell into two groups: abstract scenes that seemed to consist of what might be called mental imagery, and real scenes that seemed to have been seen through an actual pair of eyes. For example, the volcanic eruption and the man’s face were clearly things that had really been seen, while the firefly-like light in the darkness at the beginning of the tape looked like something conjured up by the mind-like something out of a dream. So Ryuji called the two groups “real” and “abstract”, for comparison’s sake. Upon further investigation, he noticed that in the “real” scenes, there were instants in which the screen was covered by what looked like a black veil, just for a split second. In the “real” scenes, these instants occurred at the rate of about fifteen per minute, while in the “abstract” scenes, they didn’t appear at all. What did this mean? Ryuji concluded that the black veil was in reality a blink. It appeared in the scenes that were seen with actual eyes, and not in the sequences that were only seen in the mind’s eye. Not only that, the frequency of the blackouts matched the average eye-blinking frequency of a female. It seemed safe, then, to consider them eyeblinks. Which led naturally to the conclusion that the images on the videotape had not been captured by exposure in a video camera, but rather taken from the vision and imagination of an individual and placed on the tape by thought-projection.

Ando had real trouble believing this part. The idea that a person could mentally imprint images onto a videotape was simply preposterous. He might be willing, just barely, to allow the possibility of mentally imprinting photographic film, but moving images? That was an entirely different set-up, first of all. In order to press on, Ando had to lay this point aside for the moment, even as he admired Ryuji’s perspicacity.

Assuming that someone had recorded the tape paranormally, the next question was: who? Asakawa and Ryuji concentrated on that point, heading to the Tetsuzo Miura Memorial Hall in Kamakura. A researcher into parapsychological phenomena, Miura had devoted his life to tracking down paranormals from all over Japan. The files containing his findings were now housed in his memorial. The two men got permission to examine those files, over a thousand in number, thinking that a psychic with powers strong enough to project moving images onto a videotape couldn’t have escaped Professor Miura’s notice. And, after several hours of searching, they’d found a likely candidate.

Her name was Sadako Yamamura. She’d been born in the town of Sashikiji, on Izu Oshima Island.

According to an entry in her file, at the age of ten she was already able to project the characters yama (mountain) and sada, elements from her name, onto a piece of film. These very characters had appeared on the video. Certain that this Sadako Yamamura was who they were looking for, Ryuji and Asakawa boarded a boat for Izu Oshima the next morning. They hoped that learning more about her upbringing and personality would illuminate some of the secrets of the videotape. Sadako was threatening whoever looked at her images with death in order to get the viewer to do something. The tape itself embodied her wish for that action to be undertaken. Which made it crucial that they find out what Sadako desired. At this point, Ryuji already had an inkling that Sadako Yamamura was no longer alive. It was his belief that on the brink of death she’d unleashed her final, unfulfilled desire in the form of a psychic projection, meaning to relay her wish to someone else. Her deepseated hatred had ended up on the videotape.

Between the assistance of the Oshima stringer for the Daily News and the help of Yoshino in Tokyo, with whom they stayed in frequent contact, Asakawa and Ryuji managed to piece together a profile of Sadako Yamamura.

She was born in 1947, the daughter of Shizuko Yamamura, a one-time paranormal who had made a big but temporary splash in the national media, and Heihachiro Ikuma, an Assistant Professor of Psychiatry at Taido University who had gotten into research on parapsychology with Shizuko as his subject. At first, the trio of Ikuma, Shizuko, and Sadako had been received by the public with simple curiosity, and in fact had become media darlings after a fashion. But once a certain prestigious academic society had pronounced Shizuko’s powers fake, the masses turned on them, and they became subject to violent attacks in the media. Heihachiro was hounded out of the university, and eventually came down with tuberculosis, while Shizuko suffered nervous attacks and finally threw herself into Mt Mihara, the volcano on Izu Oshima.

Sadako was taken in by some relatives on the island, where she lived until she graduated from high school. Once in fourth grade she gained some notoriety within the school by predicting an eruption of Mt Mihara, but aside from that she didn’t display any of the powers she’d inherited from her mother. On leaving high school she moved to Tokyo, where she joined a theater troupe in hopes of making it as an actress. It was Yoshino who picked up her trail from there.

Asakawa called Yoshino from the island and asked him to find the troupe’s rehearsal space in Yotsuya, Tokyo. He did, and once there, he found out more about Sadako’s true nature from a man named Arima, a leader of the troupe. It had been twenty-five years since Sadako had been a member of his company, but he recalled her very well. She seemed to have some sort of supernatural power; she could project images at will onto the screen of an unplugged television. If this was true, then Sadako’s powers far outstripped her mother’s. While at the rehearsal space, Yoshino succeeded in obtaining a photo of Sadako. They still had her resume on file, and it contained two black-and-white photos from when she joined. One was from the waist up, while the other was a full-length shot. Both revealed Sadako to have perfectly balanced features that went beyond even the word “beautiful”.

Yoshino was unable to determine what became of Sadako after she left the theater troupe, so he faxed the photos and the other information he’d gathered to Asakawa at the Daily News’s Izu Oshima bureau.

When he read the fax and found out that Sadako’s trail had gone cold, Asakawa was devastated. If they couldn’t find her, how could they hope to figure out the charm?

Once again it was Ryuji who had a flash of inspiration. He realized that it might not be necessary to follow Sadako’s every move. Instead, maybe they should turn their attention to the scene-Villa Log Cabin No. B-4-and try to figure out why the images had shown up there. She had to have some sort of connection with the place.

They realized that all of the buildings at South Hakone Pacific Land were new. It wasn’t impossible that something else had once stood there. Asakawa contacted Yoshino in Tokyo and asked him to try a new line of investigation: find out what had occupied that ground before the resort.

Yoshino faxed him the next morning. It turned out that there had once been a tuberculosis sanatorium on the site. He even managed to send them a plan of the facility’s layout. He also attached a file with the name, address, and resume of one Jotaro Nagao, age 57, a GP and pediatrician with a practice in Atami. For a period of five years, from 1962 to 1967, he had worked at the South Hakone Sanatorium. The suggestion seemed to be that any further information about the sanatorium would best be gleaned from Nagao.

So, armed only with what they’d learned from Yoshino, Asakawa and Ryuji took a high-speed ferry for Atami. It was one week to the day since Asakawa had watched the video. If they didn’t figure out the “charm” by ten that evening, Asakawa would die. Ryuji’s deadline was ten o’clock the next night. And Asakawa’s wife and daughter’s time would be up at eleven on the morning after.

The two men climbed back into their rented car and headed off to find Dr Nagao’s office. Their hopes to gain even a tidbit of information from him were granted, in spades. When they finally came face to face with the doctor, both Asakawa and Ryuji recognized him. Near the end of the tape there was a part in which a man was seen from the waist up, panting and sweating, blood streaming from a gouge in his shoulder. Although he’d aged and lost some hair, Nagao was unmistakably that man. Sadako had seen his face up close. Not only that, in her “eyes” he was something wicked.

With typical brashness, Ryuji pressured Nagao until he confessed everything. He told them all about that hot summer afternoon twenty-five years ago…

Nagao had contracted smallpox from a patient while on a call to the sanatorium’s isolation ward in the mountains, and that afternoon, the early symptoms of the illness were starting to show. But in spite of his headache and fever, he didn’t recognize at first that he had smallpox, and went on treating tuberculosis patients as usual. He thought it was simply a cold. Then he met Sadako Yamamura in the courtyard. She often came to the sanatorium to visit her father, who was a patient there. Having just left the theater troupe, Sadako had nowhere else to go, and she was often up to see her father.

One glance at Sadako and Nagao was overwhelmed by her beauty. He approached her and they began to talk, and then, as if guided by something beyond himself, he took her to an abandoned house deep in the woods. There, in front of an old well, he raped her. It was then that Sadako, in her desperate attempts to resist him, bit his shoulder. Between the bleeding and his feverish delirium, it took him some time to notice Sadako’s uniqueness. She had testicular feminization syndrome, an extremely rare condition in which one had both male and female genitalia. A person with this syndrome usually has breasts and a vagina but lacks a uterus and fallopian tubes. Externally, the person would appear quite female, but chromosomally would be XY-a male-and unable to bear children.

Nagao strangled Sadako and threw her body in the well. He then threw rocks into the well after her.

After hearing out Nagao’s confession, Asakawa showed him the plan of the resort and asked the doctor to show him on the map the location of the well. Nagao was able to indicate the general area-namely, where Villa Log Cabin was located now. Asakawa and Ryuji immediately sped off to Pacific Land.

Once there, they began to search for the well in the vicinity of the cabins. They found it beneath cabin B-4. The cabin stood on a gentle slope, and when they investigated the space beneath the porch they saw the rim of an old well, covered with a concrete lid. If Sadako’s hatred had radiated straight up out of the well, it would have run smack into the TV and VCR in the cabin above. The videotape was in the perfect position to pick up her psychic projections.

Asakawa and Ryuji broke a few boards, crawled under the cabin, pried the lid off the well, and set about the task of finding Sadako’s remains. That’s what both Asakawa and Ryuji now interpreted the missing “charm” to be: Sadako wanted whoever watched the videotape to release her from that cramped, dark space. The two men took turns descending into the well and scooping water out of the bottom of it with buckets. And when they finally, thankfully, fished from the mud a skull that they took to be Sadako’s, it was already after ten o’clock. Asakawa’s deadline had come and gone, and he wasn’t dead. They were satisfied that they’d figured out the secret of the videotape.

After that, Asakawa took Sadako’s remains back to Izu Oshima, while Ryuji returned to his apartment in Tokyo to work on an article. The case had been put to rest. The bones of Sadako Yamamura, possessor of fearsome psychic powers, had been rescued from the depths of the earth. She had been appeased. Neither Asakawa nor Ryuji had any doubt about that.

11

Having read that far, Ando now stood up, still holding the report, and opened the window. Imagining climbing down a rope into a well had given him the feeling that he was suffocating. It was a doubly restricted space; under the cabin it would be dark even in the daytime, and then there was the well, not even a yard across. It gave him a flash of claustrophobia; he had to breathe outside air. Directly beneath his window he could see the dark woods of Meiji Shrine swaying in the breeze. The pages in his hand fluttered too, stirred by the same current of air. The last page of the manuscript was in the printer now. One more page and Asakawa’s account would be finished. Ando heard the sound of the printer finishing its task. He glanced back at the word processor only to find a mostly blank piece of paper staring back at him.

He picked up the final page. It said:

And that was all. But it had to be of the utmost importance.

October 21 st was the day of Asakawa’s accident. The previous morning, Ando had dissected Ryuji’s body and met Mai at the medical examiner’s office. Although the manuscript ended abruptly, Ando could more or less fill in the rest himself.

On October 19th, Sadako Yamamura’s remains had been delivered into the custody of her relatives back home. But that hadn’t been the end of things after all. Even as Asakawa sat in a hotel on Oshima composing his detailed report, Ryuji was dying in his apartment in East Nakano. Upon returning to Tokyo and learning of Ryuji’s death, Asakawa had rushed to Ryuji’s apartment. There he’d encountered Mai Takano and peppered her with what seemed to her strangely inappropriate questions.

Ryuji really didn’t tell you anything at the end? Nothing, say, about a videotape?

It was easy to see why Asakawa had been in a panic. He’d been convinced that he’d escaped death by figuring out the riddle of the videotape, and now he’d found out he was wrong. The curse still lived. And Asakawa was left without a clue. Why was Ryuji dead and Asakawa alive? Not only that, Asakawa’s wife and child had a deadline of their own coming, at eleven the next morning. So Asakawa had to figure out the charm all over again, alone this time and with only a few hours to do it in. Logically, he realized that whatever it was the videotape had wanted him to do, he must have done it at some point in the past week without realizing it. Something that he could be sure Ryuji hadn’t done. What could it be? Perhaps he spent the whole night wondering. And then finally, on the morning of the twenty-first, he’d had a spark of intuition, maybe, and hit upon what he was sure was the solution. He’d made a quick note of it on his word processor.

What Asakawa meant here had to be none other than the smallpox virus. Just before her death, Sadako Yamamura had had physical relations with the last smallpox victim in Japan, Jotaro Nagao. It was natural to assume that the virus had invaded her body. Driven to the brink of extinction, the smallpox virus had borrowed Sadako’s extraordinary power to accomplish the purpose of its existence, which was to reproduce itself. But once it took the form of a videotape, the virus couldn’t” reproduce on its own. It had to work through human beings, forcing them to make copies of it. If one were to fill in the missing part at the end of the tape, it would run like this:

Those who have viewed these images are fated to die at this exact hour one week from now. If you do not wish to die, you must follow these instructions exactly. Make a copy of this videotape and show it to someone else.

In that light, things made sense. The day after he’d watched the videotape, Asakawa showed it to Ryuji, and he also made a copy for him. Without realizing it, he’d helped the virus propagate. But Ryuji never made a copy.

Sure he had the answer, Asakawa had loaded a VCR into the rented car and driven off somewhere. Undoubtedly he’d planned to make two copies of the video and show them to two other people-one for his wife, and one for his baby girl. The people he showed it to would then have to find new prey, someone else to give a copy of the video to. But that wasn’t the immediate problem. The important thing was to save the lives of his wife and child.

But just at the height of his relief at having saved the lives of his loved ones, Asakawa had reached into the back seat and touched his wife and daughter and found them cold. He lost control of the car.

Ando felt he could understand Asakawa’s catatonic state now. Not only was he devastated at the loss of his family, but he was no doubt also tormented by a question: what was the true nature of the charm? Every time he thought he had it figured out, the answer slipped through his fingers, transforming itself, claiming another life. Rage and sorrow, and an endless repetition of the question: Why? Why was he still alive?

Ando put the manuscript pages in a pile on the table. Then he asked himself: Do you really believe this cock-and-bull story?

He shook his head.

I just don’t know.

He didn’t know what else to say. He’d seen the unnatural sarcoma on Ryuji’s coronary artery with his own eyes. Seven people were dead of the same cause. In their blood had been found a virus that closely resembled smallpox. And where had Mai disappeared to? What about that odd ambience in her apartment, which she had seemingly vacated? That hair-raising intimation he’d had that something was there? The traces left on the videotape still in her VCR? Was the tape still propagating? Would it continue to claim new victims? The more he thought, the more questions Ando had.

He turned off the word processor and reached for the whiskey on the sideboard. He knew he wouldn’t be able to sleep tonight without the help of alcohol.

12

Ando first dropped by the biochem lab and returned the word processor to Ueda, and then headed to the Pathology Department. Under his arm he carried the report he’d printed out the night before. He intended to let Miyashita read it.

Miyashita sat with his head down low to the table, scratching away with a ballpoint pen. Ando dropped the report on the tabletop next to him, and Miyashita looked up in surprise.

“Listen, would you do me a favor and read this?”

Miyashita just stared back at Ando in amazement.

“What’s going on?”

“I want to know what you think of that.”

Miyashita picked up the document. “It’s pretty long.”

“It is, but there are things in there that will interest you. It won’t take long to read.”

“You’re not about to tell me you’ve been writing a novel in your spare time, are you?”

“Kazuyuki Asakawa wrote up a report about the deaths.”

“You mean, our Asakawa?”

“Right.”

Miyashita looked interested now as he flipped through some of the pages. “Hmm.”

“So, there it is. Let me know what you think when you’re done.”

Ando started to leave, but Miyashita called him back. “Hold on a minute.”

“What?”

Miyashita rested his cheek on his hand and tapped the table with the tip of his pen. “You’re pretty good at codes, aren’t you?”

“I wouldn’t say I’m particularly good at them. In med school, some friends of mine played around with them, but that’s about it.”

“Hmm,” said Miyashita, still tapping on the table.

“Why?”

Miyashita took his elbow off the printout he’d been looking at and slid it over to Ando. “This is why.” He started tapping his pen on the center of the page. It was the printout he’d seen the day before, the results of sequencing the virus found in Ryuji’s blood.

“You showed me this yesterday.”

“I know, but I just can’t get over it.”

Ando picked up the piece of paper and held it up in front of his face. Into several points in an otherwise unordered sequence of bases, a string of bases in the same order had been inserted.

ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA

No question, it was strange for the same string of forty-two bases to appear several times at appropriate intervals.

“And Ryuji’s virus is the only one like this?”

“Right. His is the only one with these extra forty-two bases,” Miyashita said, his gaze not wavering from Ando’s. “Doesn’t that strike you as weird?”

“Of course it does.”

The tap-tap of the ballpoint pen ceased.

“The thought crossed my mind that it might be a sort of code.”

Ando gulped. He couldn’t remember having told Miyashita anything about what had happened after Ryuji’s autopsy. Not about the corner of newspaper, and certainly not about the fact that he’d come up with the word “ring” from it. And yet now Miyashita was talking about codes.

“Assuming it is a code, who’s sending it?”

“Ryuji.”

Ando screwed his eyes shut. The idea was one he’d been desperately trying to avoid entertaining, and now Miyashita was shoving it in his face.

“Ryuji’s dead. I performed the autopsy myself.”

Miyashita didn’t seem fazed in the least. “Well, whatever. Just see if you can decipher this, okay?”

Was it really possible that the sequence of bases could be somehow turned into a word? Just as the digits 178136 had quickly yielded RING, maybe these forty-two letters could be made to form words. Maybe they did carry some important message. Had Ryuji himself, from beyond the grave, inscribed this over and over in his own remains?

Ando’s hand, clutching the printout, trembled as he felt himself being driven into the same blind alley as Asakawa. But there was no way he could refuse Miyashita’s outright request. The idea that it might be a code had occurred to Ando, too, the first time he’d seen the sequence, but he’d buried the thought in the depths of his brain. He was afraid that if he didn’t, the scientific framework on which he’d hung his life would be bent further out of shape. Things were threatening to go beyond his ability to absorb them.

“You can keep that. Take your time and see what you can do with it.”

Miyashita was supposed to be a scientist. Ando couldn’t understand how he could bandy about these unscientific ideas so readily.

“I have faith in you. You’ll figure it out,” said Miyashita, giving Ando a pat on the butt.