Loop

1

Recently Kaoru had begun to look older than his twenty years. It wasn't so much that his face had aged as that his unusually large frame projected a robust presence. He exuded an air of adulthood. People he met tended to tell him he was mature for his age.

Kaoru thought that was only natural, considering how he'd been forced to become his family's pillar of strength at the age of thirteen. Ten years ago, in elementary school, he'd been skinny and short, and people had often thought him younger than he was. Supposedly he'd been something of a know-it-all, tutored as he'd been in the natural sciences by his father and in languages by his mother. His main job had been to give his imagination free reign, to wonder about the structure and workings of the universe, rather than to involve himself in mundane chores.

Ten years ago-it felt like another world altogether. Back then, playing with his computer, sitting up talking with his parents into the wee hours of the night, the road ahead of them had been clear and without shadow. He could remember how he'd started thinking about longevity and gravity, and how that had turned into a family plan to visit the Four Corners region of North America. He'd even gotten his father to sign a pact to that effect.

Kaoru still kept that contract in his desk drawer. It had never been fulfilled. Hideyuki still wanted to honour it, but Kaoru the medical student knew better than anybody how impossible that was.

Kaoru had no skill that could tell him when or by what route the Metastatic Human Cancer Virus had infiltrated Hideyuki's body. No doubt the virus had turned one of his body's cells cancerous years before he first complained of stomach problems. Then that newborn cancer cell had probably undergone its first cellular division not long after he'd promised that trip to the desert. And those cancer cells had silently, steadily reproduced themselves until the family trip had become an unattainable dream.

Hideyuki's initial plans to visit some laboratories in New Mexico had been delayed; only three years after the initial promise had he been able to finally work the visits into his schedule. He'd arranged for a three-month stint at the Los Alamos and Santa Fe research centres. He'd planned to depart for New Mexico two weeks early, so he and Machiko and Kaoru could visit the site of the negative gravitational anomaly that still fascinated Kaoru so.

And then in early summer, two months before they were scheduled to leave-after they'd already bought the plane tickets and the whole family had their hearts set on the trip-Hideyuki suddenly complained of stomach pain.

Why don't you see a doctor, Machiko said, but he wouldn't listen. Hideyuki decided it was a simple case of gastritis, and made no lifestyle changes.

But as the summer wore on, the pain became worse, until finally, three weeks before their departure date, he vomited. Even then, Hideyuki insisted it was nothing. He kept refusing to be examined, reluctant to cancel the plans they were so excited about.

Finally, though, the symptoms became unendurable, and he agreed to go to the university hospital and see a doctor who happened to be a friend of his. The examination found a polyp in his pylorus, and he was admitted to the hospital.

Naturally, the trip was cancelled. Neither Kaoru nor Machiko was in any mood to travel. The doctor in charge informed them that the polyp was malignant.

Thus did Kaoru's thirteenth summer turn from heaven into hell: not only did the trip fall through, but he and his mother ended up spending most of the sweltering summer going back and forth to the hospital.

Don't worry, I'll get better next year, and then we'll go to the desert like I promised, just you wait and see, bluffed his father. Their one comfort was Hideyuki's positive attitude.

Machiko believed her husband, but, at the same time, whenever she let herself imagine what might happen, she became despondent. She grew weaker emotionally, and physically.

And that was why it fell to Kaoru to take a central role in the family. It was Kaoru who stood in the kitchen and made sure his mother ate enough when she couldn't bring herself to think about food; it was Kaoru who swiftly absorbed enough medical knowledge to plant thoughts of an optimistic future in his mother's head.

There was an operation in which two thirds of Hideyuki's stomach was removed, and it went well; if the cancer hadn't metastasized, there was every chance he'd get well. By the beginning of autumn Hideyuki was able to return home, and to his laboratory.

It was around that time that a change began to appear in Hideyuki's attitude toward Kaoru. On the one hand, as a man he had a new respect for the dependability his son showed while he was in the hospital, but on the other hand he began to be stricter with his son out of a new determination to make him into a stronger man.

He stopped calling him "kiddo", and encouraged him to spend less time on his computer and more time exercising his body. Kaoru didn't resist, but went along with his father's new expectations: he could detect certain desperation in his father, as if he wanted to transfer something from his own body to his son's before it disappeared.

He knew his father loved him, and he felt special, as if he'd inherited his father's will; pride coursed through him.

Two years passed uneventfully, and Kaoru's fifteenth birthday came around. But changes had been taking place inside his father's body. Those changes were revealed by a bloody stool.

This was a red light signalling the spread of the cancer. With no hesitation this time, Hideyuki saw the doctor, who gave him a barium enema and x-rayed him. The x-ray showed a shadow on the sigmoid colon about half the size of a fist. The only conceivable course of action was surgery to cut it out.

There were, however, two possibilities for the surgery. One option would leave the anus; the other would remove more tissue and require the insertion of an artificial anus. With the former, there was the fear that they would miss some of the invading cancer cells, leaving the possibility of a recurrence, while the latter option of removing the entire sigmoid colon allowed for more surety. The doctor's opinion was that from a medical standpoint the artificial anus would be preferable, but because of the inconvenience and lifestyle changes that would bring, he had to leave the final decision up to the patient.

But Hideyuki didn't flinch as he coolly chose the artificial anus. If you open me up and can't say with certainty that the cancer hasn’t spread that far, then I want you to cut it all out without hesitation, he'd volunteered. He intended to bet on the option with the best odds of survival.

Once again the summer found him back in the hospital for surgery. When they cut him open, the doctors found that the cancer hadn't invaded as far as they had feared; normally, in this situation, leaving the anus in would give at least even odds of success. But the surgeon in charge decided, in view of the patient's expressed wishes, to remove the sigmoid colon entirely.

Once again autumn found Hideyuki checking out of the hospital. For the next two years he'd lived in fear of signs of a relapse, as he strove to get used to life with a colostomy.

Exactly two years later there was another sign, this one a yellow light, as it were. Hideyuki became feverish and his body took on a yellowish cast, symptoms that got worse day by day. One look at his jaundiced condition told the doctors that the cancer was attacking his liver.

The doctors hung their heads. They thought they'd made sure, over the course of two previous surgeries, that the cancer hadn't spread to the liver or lymph nodes.

It was at this time that Kaoru began to suspect that what they were seeing was the emergence of some unknown illness, something that was indeed a kind of cancer, but one different from those previously known. His interest in basic medicine intensified. In the summer of his seventeenth year, having graduated from high school a year early, he entered the pre-med program in the same university that his father had attended.

The third time he lay down on the operating table, Hideyuki lost half his liver. He subsequently checked out of the hospital, but neither Kaoru nor Machiko could make themselves believe now that the battle with cancer was over. The family watched for enemy movements with bated breath, wondering where the cancer would invade next; the return of a peaceful, happy home life was something hardly to be hoped for.

That cancer won't rest until every organ in his body has been plucked out, Machiko insisted, and she wouldn't listen to any of Kaoru's medical knowledge. If she heard about a new vaccine, she'd scramble to get her hands on it even before it was fully tested. Hearing vitamin therapy was effective she tried that; she pressured the doctors into trying lymphocyte treatment; she even sought salvation in charismatic religion. She was willing to try anything-she couldn't swear she wouldn't sell her soul to the devil if it would save her husband's life. It depressed Kaoru to see his mother running around like a woman possessed. It was beginning to look like his father's death would also mean the collapse of his mother's psyche.

After that, Hideyuki spent most of his time in his hospital bed. He was still only forty-nine, but he looked like an old man of seventy. His hair had fallen out as a side-effect of the anti-cancer drugs, he was emaciated, his skin had lost its luster, and he was constantly running his fingers over his whole body and complaining of itchiness. But even so, he never lost his attachment to life. As his wife and son sat by his bedside he'd hold their hands and say, ''You listen to me, next year we're going to that desert in North America." And he'd force a smile. It wasn't exactly false cheer-he obviously fully intended to fight this illness so he could keep his promise. The sight was both reassuring and painful.

As long as his father showed such a positive attitude toward life, Kaoru never entertained thoughts of giving up. No matter how bad the cancer got, Kaoru believed his father would conquer his illness in the end.

At around this time, a type of cancer with the same progression as Hideyuki's began to be identified, first in Japan, then worldwide. At first the true cause of this new strain could not be identified, as if it lay wrapped under a veil. A few medical professionals supported a theory that it was the work of a new virus that turned cells cancerous, but they couldn't explain how this cancer virus differed from others, and besides, there had been no reports of such a virus being successfully isolated. But the vague suspicion spread.

It can take several years after a new disease has been identified to pinpoint the virus that causes it. The lag was especially understandable in the case of the cancer that had afflicted Hideyuki and millions of others, because at first it looked just like any other cancer: nobody realized they were dealing with a new disease. But gradually the world came to be gripped by fear that a terrible new virus had been unleashed.

Finally, one year ago, the new cancer virus had been successfully isolated in a laboratory at the medical school of Fukuzawa University. With that they had proof: a virus was the cause of this metastatic cancer.

The new virus was named the Metastatic Human Cancer Virus, and it was thought to have the following characteristics.

First, it was an RNA retrovirus that actually caused normal cells to become cancer cells. Thus, anyone infected with the virus ran the risk of developing cancer, regardless of whether or not they had been exposed to carcinogens. However, there was room for individual variation: there were confirmed cases, though only a few, of infected people who were mere carriers, never developing cancer themselves. It took on average three to five years from the time of infection for the cancer to grow large enough to be detected clinically, although the degree of individual variation in this was great.

Second, the cancer was contracted through the direct introduction of virally-infected lymphocytes into the body. That is, it was not spread through the air, but through sexual contact, blood transfusions, breastfeeding, and similar contact. Thus, it was not what would be called highly contagious. But there was no definitive evidence to say that it would not at some point in the future become transmissible through the air. This virus mutated with frightening speed.

Due to the similarity in the manner of its transmission, some scholars speculated that the new virus was the result of some sort of mutation in the AIDS virus. Perhaps the AIDS virus had sensed that it was about to be eliminated by vaccines, and so had colluded with an existing cancer virus, skilfully changing its appearance. And indeed, there was a nasty resemblance between the two viruses, not only in how they spread, but in the way they nested in cells in the human body.

When the Metastatic Human Cancer Virus, carrying reverse-transcription enzymes, merged with human cellular tissue, the RNA and reverse — transcription enzymes were released to synthesize the double helix of DNA.

Then, this synthesized DNA mingled with normal cellular DNA, turning the cell cancerous. Which was bad enough. But it didn't end there. The cell could now no longer tell the difference between its own DNA and the viral DNA, and so it kept manufacturing the cancer virus and releasing it outside the cell. The released virus made its way into the bloodstream and the lymph stream, where it deviously fought off attacking immune cells while awaiting the chance to move into a new host.

The third characteristic: when the cancer started, almost without exception it metastasized and spread throughout the body with frightful strength. This, of course, was why it was called the Metastatic Human Cancer Virus.

There are benign tumours and malignant ones, and the difference between them lies in the thorny questions of invasiveness and metastasis. A person may develop a tumour and still have no reason to fear, as long as it doesn't spread through the surrounding area, move into the blood and lymphatic vessels, and metastasize.

But this metastatic cancer spread through rapid reproduction and extreme invasiveness, and was highly resistant to the immune-system attacks it experienced as it circulated through the lymph and blood streams. It was much more likely than normal cancer to survive in the circulatory system.

As a result, anyone who came down with this cancer had to assume a 100 % probability that it would metastasize. The question of whether or not one survives cancer can be restated in terms of whether or not one can prevent that cancer from metastasizing. With a 100 % chance of metastasis, it was essentially impossible to hope for a complete recovery from MHC.

The fourth characteristic was that the cancer cells created by this virus were immortal-they would live forever if their host didn't die.

Normal human cells have a limit to the number of times they can divide over the course of their existence-just like humans themselves, they have a certain span of life allotted to them at birth. For example, by the time a person becomes an adult, his or her nerve cells have lost their ability to reproduce themselves, so that they are no longer replenished. It might be said that nerve cells have the same lifespan as humans do.

In this way, the aging and death of cells is intimately connected with the question of human lifespan. But these cancer cells, when removed from a host and sustained in a culture fluid, went on dividing infinitely-they would never die.

There were certain religionists who pointed to this and spoke of it in a prophetic vein, saying, If we could harness the power of these cancer cells and transfer it to normal cells, we would be able to achieve immortality-we’d never grow old.

But of course these were nothing but amateurish delusions. It was paradoxical that cells which had achieved immortality would then kill their human hosts, assuring that they themselves would die. But it was a paradox that, by and large, people managed to accept.

2

It was the rainy season, early summer of the year before Kaoru was to take his national examinations, and every day was a busy one for him. Visiting his dad and working a part-time job took up so much of his life that he barely had time to look after his mother's mental state-much less study.

If left to her own devices, his mother would try to get her hands on anything that claimed to be effective against cancer; Kaoru had to keep a constant watch so it didn't get out of control.

Hideyuki didn't approve of his son spending so much energy on his part-time job. He felt that his son should concentrate on studying, and that splitting his time between that and working was essentially a waste. The idea that Kaoru was doing it on account of his own illness irritated him even more: Hideyuki insisted that he could pay for Kaoru's school expenses, that they had enough money in savings. As far as talking big went, he was as healthy as ever; but the optimism in his words was Kaoru's salvation.

In reality, Kaoru was the one who held the family's finances in his hands, and he knew that they didn't have much to spare. He had to keep his job. But of course he wasn't about to complain to his father about their budgetary straits. There was nothing to be gained by letting his father know things were tight. So Kaoru lied to Hideyuki, telling him that he worked because he wanted more spending money.

When they were together, Kaoru wanted to set his father's mind as much at ease as possible. It wouldn't do to betray the fact that because his illness had decreased the family's income, Kaoru and his mother were having to squeeze by. Luckily, as a medical student Kaoru had no trouble hanging out his shingle as a tutor, and in fact he made quite a bit of money that way. The hospital connected to Kaoru's medical school had a lot of child patients whose parents didn't want them to fall behind in their studies when they went back to school; tutors were always in demand.

One day early in his summer vacation, Kaoru visited the hospital to tutor a junior high schooler in math and English, and then had a light lunch in the cafeteria. His father was a patient in this very hospital. Kaoru had just heard that there was a possibility that the cancer had spread to his father's lungs; his mood was black. His father had recently gone into his annual litany. This year, he said, we 're going to see those longevity zones in the North American desert. But the words had rung hollow. And then came-as if on cue-the indications that the cancer had spread.

Kaoru was sitting in the cafeteria, sighing over his father's illness and his family's future, when he saw Reiko Sugiura and her son Ryoji.

The cafeteria was on the third floor of the hospital, surrounding a courtyard on three sides; the walls facing the courtyard were of glass. There was a fountain in the courtyard, and sitting at a table in the cafeteria one was eye level with the top of its spray. The cafeteria was so carefully decorated, and its food so pleasant to the taste, that it felt more like a stylish outdoor cafe than part of a hospital. Gazing at the water from the fountain had a truly relaxing effect.

Kaoru's eyes were drawn naturally toward the beautiful woman being shown to an empty table.

Her tanned body was sheathed in a summery beige dress, and her face was so nicely formed that it was eye-catching even without the aid of cosmetics. If it weren't for the child at her side, she could have passed for ten years younger than what Kaoru guessed she had to be.

The woman and boy sat at the table the waiter indicated, which happened to be diagonally adjacent to Kaoru's. Kaoru watched them seat themselves, and, after that too, he found his attention drawn to the woman, his eyes riveted to the legs stretching out from beneath her mini dress.

He realized this was the same mother and child he'd seen at the hotel pool two weeks ago. One of his students' grades had gone up so much that the kid's parents had given Kaoru an all-summer free pass to that pool. On the first day he'd gone to swim there he'd encountered this pair, sitting poolside in deck chairs.

From the first moment he'd laid eyes on the woman in the green bathing suit, he was sure he'd seen her somewhere before, but when and where he couldn't say. Kaoru was normally confident in his powers of recall, but poke about as he might in the recesses of his memory he couldn't place the woman. The experience left him with an unpleasant aftertaste that wouldn't go away. A woman as beautiful as this he wouldn't expect to forget, and yet evidently he had. At the time, he'd tried to put her out of his mind, telling himself he was mistaken, but then something about her finally triggered memories of the star of a soap opera he'd watched as a child. He wondered if it was the same woman.

The boy made an odd impression, particularly his physique. The blue swim cap that he wore pushed back on his head, the goggles, the check-pattern shorts that Kaoru could tell at a glance weren't for swimming in, his skinny bowed legs, and most of all his abnormally white skin. He resembled an "alien corpse" Kaoru had seen on some fake TV show a long time ago. Everything about the boy looked strangely off-kilter. The pair stuck in Kaoru's memory: this woman he'd seen somewhere before and this weird-looking boy.

And now they were sitting at the next table over. Kaoru, sitting by the window so he could gaze down at the fountain, found he could catch their reflection faintly in the glass. He observed this instead of staring at them directly.

After a few moments, Kaoru figured out why his first impression of the boy had been of unbalance. It was his hair, or rather his lack of it. When Kaoru had first seen the boy poolside, his swim cap had been missing the bulge that would normally have told of a full head of hair.

Today, too, the boy was wearing a hat when he sat down at the table, but after a few moments he took it off, revealing his head to be perfectly devoid of hair.

Kaoru realized what that meant. The boy was here to be treated for cancer. He'd assumed mother and child were both here to visit a patient, but now it turned out that the mother was accompanying her son to chemotherapy. Hideyuki was undergoing chemotherapy, and his hair too had fallen out, but somehow seeing a child suffer that side effect was even more heart-rending. Kaoru thought about that day at the pool, that swim cap hugging the boy's bare scalp directly-no wonder he'd left such a peculiar impression.

Kaoru rested his head on his hand and watched the beautiful thirty-something woman and her son, who was probably a fifth or sixth grader, eat their lunches without talking. Without being conscious of it, he was comparing them to his father, hospitalized here. His father was forty-nine, while this boy had to be eleven or twelve. Both were taking anti-cancer medication.

The mother in her airy beige dress looked too bright and cheerful for a hospital. Once in a while she raised her head and glanced out the window. She didn't look like she was tasting what she ate-she was just eating to eat, looking at no one in particular with an expression that could have been a smile or the equivalent of a sigh.

She paused with her spoon in the air, then returned it to the plate, then started to bring it to her mouth again, and then suddenly shot a glance in Kaoru's direction. At first her gaze was sharp, as if to ask, What are you looking at? But as her eyes met Kaoru's her gaze softened. Kaoru found himself unable to look away.

It seemed she recognized him from the pool. She looked like she wanted to say something. Kaoru bowed his head slightly, and she answered with the same gesture.

And then her attention was taken up by her son, who chose that moment to toss aside his chopsticks and spoon and throw a tantrum. The sight of Kaoru fled her mind.

Even then Kaoru continued to watch the two. He was powerless to resist-it was as if his consciousness had been uprooted and physically carried to where they were.

Several days later, in the courtyard this time, Kaoru had the opportunity to speak to this mother and her child. By some lucky chance they ended up sitting side by side on the same bench, making it possible for a conversation to start naturally without either one making the first move.

The mother introduced herself as Reiko Sugiura and her son as Ryoji. Ryoji's cancer, which had first appeared in his lungs, now looked like it had spread to his brain, and his days were filled with tests preparatory to radiation and chemotherapy.

Not only that, but it seemed that the agent that had turned his cells cancerous was none other than the recently isolated Metastatic Human Cancer Virus-the progress of the illness, from first appearance through subsequent metastasis, was nearly identical to Kaoru's father's case.

Kaoru felt a sense of kinship. A sense that they were comrades fighting the same enemy.

"Brothers in arms."

The expression was Reiko's, but it echoed Kaoru's thoughts. However, Kaoru doubted her words, having observed their expressions in the cafeteria the other day. It was resignation he'd seen then, wasn't it? At the very least, their faces hadn't been those of people dedicated to battling an illness. Kaoru still remembered the affectless way she'd eaten.

He took this opportunity to clear up the doubt that had been nagging at him since their first encounter.

"Haven't we met somewhere before?" It embarrassed him as he said it, it sounded so much like a pickup line, but he couldn't think of any other way to ask it.

Reiko responded with a laugh whose import escaped him. "I get that a lot. I'm told I look like an actress on an old TV show," she said shyly.

It sounded like a lie to him. She didn't just look like the actress-he couldn't help but think they were one and the same. But if she was the actress, and was lying so she could escape her past, then he didn't feel he should press the issue.

When they parted, there in the courtyard, Reiko gave him their room number and said, "Why don't you come visit us sometime? Please."

Three times they'd met, he and Reiko Sugiura. Now more than ever, he couldn't take his eyes off her.

3

It was the very next day that Kaoru took Reiko at her word and knocked on the door to Ryoji's room.

Reiko greeted him, with a smile that might have been a bit overdone, and showed him into the room. Ryoji was sitting up in bed reading a book, his legs dangling over the side. As a medical student, Kaoru knew how much the room cost the moment he entered. It was a private room with a private bathroom complete with bathtub. The daily rate was five times that for a normal shared room.

"Thank you for coming," Reiko managed to say. Evidently she'd only invited him as a social courtesy, not really expecting him to come. Now that he was actually here she couldn't disguise her happiness. She turned to Ryoji and tried to stir his interest. "Look who's come to see you!"

It hit Kaoru that Reiko had invited him up as someone for her son to talk to. He should have realized it before.

It was Reiko, not Ryoji, who had piqued Kaoru's interest. Kaoru didn't know much about women, but he'd sensed something sexual, some kind of desire, in her unwavering gaze. She had full lips and wide, alluring eyes that drooped a little at the corners; her breasts weren't especially large, but still there was something undeniably feminine in her five-foot frame. She had a refined air about her that he hadn't found in women his own age, and it aroused something within him.

In comparison with that, there was nothing for him to hold onto in Ryoji's gaze. As he sat down facing the boy in the proffered chair, he was astonished at how little light the boy's eyes held. Ryoji didn't even try to meet Kaoru's gaze. He was looking in Kaoru's direction, but plainly he wasn't seeing anything. His eyes looked right through Kaoru, their gaze wandering across the wall behind. For a long time, they wouldn't focus.

Ryoji set his book down on his knee with a finger still stuck in between the pages. Trying to find something to talk about, Kaoru leaned forward to see what the boy was reading.

The Horror of Viruses.

Patients want to know as much as possible about their illness. Ryoji was no exception. Naturally he was concerned about this foreign thing that had invaded his body.

Kaoru informed the boy that he was a medical student, and asked him a few questions about viruses. Ryoji answered him with a level of accuracy and detail astonishing in a sixth grader. Clearly he understood a great deal about viruses. Not only did he understand how DNA worked, he even had his own views on matters at the farthest reaches of current knowledge about the phenomenon of life.

As they went back and forth, questioning and answering, Kaoru began to imagine he was looking at a younger version of himself. He looked on this child, armed with scientific knowledge, the same way his father had looked on him. Kaoru felt like an adult.

But it wasn't to last long. Just as they had warmed up to each other, just as the conversation was really taking off, Ryoji's nurse showed up to take him to an examining room.

Kaoru and Reiko were alone now in the small sickroom. Kaoru was suddenly fidgety, while Reiko, who had been leaning on the windowsill, now coolly came over and sat down beside the bed.

"I had no idea you were twenty."

Kaoru had mentioned his age during his conversation with Ryoji; Reiko had noticed. Kaoru was always being told he looked older than he was; he was used to it.

"How old do I look to you?"

"Hmm. Maybe about five years older…?" She trailed off apologetically, afraid she'd offended him.

"You mean I look old?"

"You look mature. Really… together." To say he looked old might hurt him; to say he looked "mature" would sound like a compliment, she evidently figured.

"My parents got along well when I was growing up."

"And that makes kids look older than their age?"

"Well, they always looked like they'd be happy enough to be left alone, just the two of them, so I had to learn to be independent pretty early."

"Ah." Reiko's expression said she wasn't convinced. She looked at her son's empty bed.

Kaoru found himself thinking about Reiko's husband. Something about Ryoji suggested that he didn't have a father. Maybe there had been a divorce, maybe he'd died, or maybe he'd been absent from the start. In any case, Kaoru had the impression that Ryoji's relationship with his father was, at the very least, extremely attenuated.

"In that case, maybe my son will never become independent," said Reiko, still staring at the bed.

Kaoru braced himself and waited for her next words.

"It was cancer…"

"Oh." He had expected that.

"It was two years ago. Ryoji didn't mourn his father's death one bit, you know."

Kaoru could understand that. The kid probably hadn't let her see him cry once.

"That's how it is sometimes."

But he didn't mean it. When he imagined his own father's death an uncontrollable sadness came welling up from the depths of his heart. He wasn't sure he'd be able to overcome it when he faced the actual event. He realized that, at least in that sense, maybe he wasn't all that independent yet himself.

"Kaoru, would you mind…" Reiko trailed off again, fixing him with a clinging gaze. "Would you mind watching over his studies?"

"You mean, as his tutor?"

"Yes."

Teaching children was his specialty, and he had time for one or two more students. But he wasn't sure Ryoji actually needed a tutor. Just from their brief talk together it was obvious that Ryoji was far more capable than other students his age.

But it wasn't only that. If the cancer had already spread to his lungs and his brain, Kaoru knew that all the tutors and all the studying in the world wouldn't make any difference in the end. There was no chance that this kid would return to school. But then, maybe that was precisely why she wanted to hire a tutor, in the hopes that letting him prepare to go back to school and resume his studies would restore his faith in the future. Kaoru knew how important it was for those surrounding the patient to show by their actions that they hadn't given up hope.

"Sure. I have time to come by twice a week, if that would do."

Reiko took two or three steps toward Kaoru and placed her hands demurely in front of her, one over the other. "Thank you. Not only will it benefit his schoolwork, but I'm sure he'll be happy to have someone to talk to."

"Okay, then."

No doubt Ryoji didn't have a friend in the world. Kaoru could understand, because he'd been the same. He'd been just a little of a social outcast at school. But in his case, he'd had a good relationship with his parents that had saved him from feeling lonely. Crazy as his father could be, he'd been the best possible conversation partner for Kaoru. With his father and mother around, Kaoru hadn't been inclined to wonder why he'd been born into this world. He'd never had doubts about his identity.

What Reiko sought in Kaoru was a father figure for her son. Kaoru didn't have a problem with that. He was confident he could play that role, and do it well.

But, he wondered: Does she also want a husband figure for herself?

Kaoru's imagination began to run away with him. He wasn't as confident on that score. But he wanted to at least try to be the man Reiko needed.

They arranged a date and time for his next visit. Then Kaoru left Ryoji's hospital room.

4

Kaoru and Ryoji ended up talking with each other a lot, even outside their scheduled lessons. Usually their talks ended up focusing on general science topics. Kaoru was reminded of his own childhood, when his desire to understand the world had led him to delve deeply into natural science.

At one time, Kaoru had desired to formulate a system or theory that would encompass and explain things normally dismissed as non-science-paranormal phenomena. But the more he learned, the more he came to see that no matter what unified theory he came up with, there would still be phenomena that couldn't be accounted for within it. That realization combined with his father's illness turned his exploring impulses into an interest in a practical field of study, namely medicine.

Kaoru snapped out of his reverie and looked at Ryoji, a younger fellow inquirer into the workings of the universe.

Ryoji was sitting cross-legged on his bed as always, rocking gently back and forth. Reiko was in a chair by the window, watching them talk, and she must have been fairly sleepy, for she'd started moving her head back and forth in time with her son's movements.

"So is that what you're interested in right now?"

Ryoji had been peppering Kaoru with questions about genetics.

"Yeah, I guess so."

Ryoji turned his normally hollow gaze forward and began to stretch where he sat on the bed. He was smiling like he always did, although there was nothing funny about what they were discussing. It wasn't a healthy smile. It was the desperate grin of someone at the end of his own life scorning the world. Kaoru thought he'd gotten used to it, but it could still annoy him if he looked at it long enough. If his father smiled like that, he'd give him a good talking-to-he'd rip into him, father or not.

There was only one way to wipe that smile off Ryoji's face: goad him into a passionate debate.

Kaoru changed the subject. "So what are your thoughts on the theory of evolution?" It was a natural progression from genetics.

"What do you mean?" Ryoji squirmed and rolled his eyes at Kaoru.

"Okay, how's this for starters? Does evolution move randomly or toward a predetermined goal?"

"What do you think?" This was one of Ryoji's less pleasing habits. He always tried to ferret out his interlocutor's thinking first, instead of coming straight out with his own opinion.

"I think evolution moves in a certain direction, but always with a certain latitude for choice." Kaoru couldn't bring himself to give a ringing endorsement of mainstream Darwinian evolutionary theory. Even now that he was taking his first steps toward becoming a specialist in a natural science, he couldn't completely abandon the idea that there was a purpose behind it all.

"The direction theory. That's pretty much what I believe, too." Ryoji leaned toward Kaoru, as if he'd accomplished something.

"Shall we start with the emergence of life?"

"The emergence of life?" Ryoji looked truly astonished.

"Sure. How you look at the emergence of life is an important question."

"It is?" Ryoji furrowed his brow and looked like he wanted to get out of this question but quick.

Kaoru didn't appreciate this attitude of Ryoji's. For a kid like him it should be fun to play around with questions like this. The question of why life on earth was able to gain the ability to evolve was intimately connected with the question of how life first emerged on earth. Kaoru, at least, had gotten a lot of enjoyment out of debating this with his father.

"Well, let's move on, then. Let's grant that life emerged, by some mechanism we don't yet understand. So, next…" Kaoru stopped to let Ryoji step in.

"I think the first life on earth was something like a seed. That seed contained the right information so that it could sprout, grow, and eventually become the tree which is life as we know it, including humankind."

"Are there no variations?"

"Yes and no. The biggest tree grows from the tiniest seed. The size of the trunk, the colour of the leaves, the type of fruit-all that information is already contained within the seed. But of course the tree is also influenced by the natural environment. If it doesn't get sunlight it'll wither, if it doesn't get enough nutrients the trunk'll be thin. Maybe it'll be struck by lightning and split in two, maybe its branches will break in a gale. But no amount of unpredictable influence of that kind can change the basic nature of the tree as contained in the seed. Come rain or snow, a ginkgo tree will never bear apples."

Kaoru licked his lips. He didn't mean to contradict Ryoji. He basically agreed with him, in fact.

"So you're saying that if sea creatures learn to walk on land, if giraffes develop long necks, it's all because they were programmed that way from the start?"

"Well, yeah."

"In that case, we should assume that there was some kind of will at work before life began."

Ryoji responded innocently. "Whose will? God's?"

But Kaoru wasn't thinking about God per se, just an invisible will at work both before life began and during the process of evolution.

He found himself imagining a school of fish fighting with each other to get to land. There was an overwhelming power in the thought of all those fish, enough of them to dye the sea black, jumping around as they sought dry land.

Of course it was possible that sea life had never intended to go on land, but had simply succeeded in adapting to it after orogenic processes had begun to dry up the water. That was how the mainstream evolutionary thinker would explain it.

But the image that came to Kaoru's mind was of those hollow-eyed fish, yearning day in and day out for the land, dying at the water's edge and making mountains of their corpses. Mainstream evolution had it that a certain fraction of them had simply been lucky enough to adapt. Kaoru simply couldn't believe that. The transition from a marine to a land-based living environment involved changes in internal organs. Their insides had to be remade to allow for the transition from gill breathing to lung breathing. What kind of bodily trial and error had resulted in those changes? One kind of organ had been reborn as another. It was pretty major, when you thought about it.

Right in front of Kaoru was Ryoji's bald head. Because Ryoji was hunched over, the top of his head came up to the tip of Kaoru's nose. At this very moment, within that emaciated little body, a violent cellular conflict was being enacted. As it was within Kaoru's father Hideyuki. He'd lost most of his stomach, part of his large intestine, and his liver. And still, more as-yet-unknown cancer cells had taken up residence in some new spot in his body and were writhing there even now.

An unexpected inspiration came to Kaoru.

Cancer cells invaded a normal organ, changing its colour and shape and constructing new bulges, until the normal functioning of the organ was impaired and it died. The obviously negative aspects of this were what stood out, but at the same time it was possible to detect in the cancer's actions a certain groping towards something. By infiltrating the blood and lymph to penetrate cells elsewhere, it was experimenting with transplanting its immortal nature bit by bit. But to what end?

To create somewhere within the body a new organ adapted to the future. Maybe the Metastatic Human Cancer Virus was nothing but a sort of trial-and-error attempt to create a new organ.

In the process, large numbers of human beings would die, just as most of the fish had died at the water's edge. But just as after a hundred million years sea life had finally made it onto the land, someday, after countless sacrifices, maybe the human race would find itself with a new organ. Humanity would have evolved. Maybe an evolutionary leap comparable to the movement from the water to the land was impossible without something like a new organ. When would it happen?

Human cancer deaths were surging upward, but without knowing when the cancer cells had started their work it was impossible to know if the human race had just begun its fumbling toward evolution, or was about to complete it. The only thing certain was that the pace of evolution was accelerating. The time it took for apes to evolve into humans was shorter than what had been needed for sea creatures to evolve into amphibians, so much shorter that there was almost no comparison. So it was possible. The intervals in the evolutionary process were gradually getting shorter, so maybe it wasn't too soon for this to be evolution, too.

Kaoru wanted to think so. He wanted to turn his attention to anything that would afford him hope. He wanted to believe that his father would be the first one to successfully evolve, rather than just another sacrifice.

To be reborn. Kaoru would have wanted that, if it were possible. No doubt everybody wanted to live again. The gift of eternal life.

Since it was a property of the MHC virus to create immortal cells, it was only natural to fantasize about human immortality. Maybe even Ryoji had a chance.

Kaoru almost said so, but bit back the words. Anything that sounded like an affirmation of the illness might have the effect of loosening the boy's attachment to living.

He heard faint snoring right behind him. Reiko, who had been nodding off for some time, had finally lowered her face to the table and gone to sleep. Kaoru and Ryoji looked at each other and giggled.

It was still early, not even eight o'clock. Outside the window, the evening cityscape was starting to emerge from the summer dusk. From below the window came the sounds of highway traffic, suddenly loud.

Reiko's elbow twitched, knocking an empty soda can to the floor, but she didn't awaken.

Kaoru spoke cautiously. "Your mom's asleep. Maybe it's time I was leaving." The lesson had ended long ago.

"Weren't you about to say something to me just now, Kaoru?"

Ryoji looked discontented, as if he hadn't had his fill of talking yet.

"We'll pick up where we left off next time."

Kaoru stood up and looked around the room. Reiko had gone to sleep with her right cheek pillowed on her hands and her face turned in his direction. Her eyes were closed but her mouth was half open, and the back of her hand was wet with drool. Fast asleep, she looked quite cute.

It was the first time he'd thought that about a woman ten years older than him. Kaoru felt affection for her entire body, and harbored a momentary desire to touch her.

Ryoji reached out and shook her shoulder. "Mom, Mom." She still didn't wake up.

"It's no good. She's out like a light."

Ryoji trained his innocent eyes on Kaoru, and then on the extra bed provided for relatives accompanying the patient. "Mom gets tired taking care of me, so I like to let her sleep when she can. She'll have to wake up in the middle of the night tonight anyway," he said, as if he weren't making a veiled entreaty.

Kaoru felt an unaccustomed warmth in his body, as if Ryoji had managed to peek inside his heart. He realized that what the boy was really saying was, Would you pick her up and move her to the extra bed real gently so she doesn't wake up?

If he could manage to pick her up, it was only about six feet to the bed. Reiko's knees beneath her short culottes were pressed tightly together as if to fend off any attempts to touch her. Carrying a woman to bed was nothing for someone of Kaoru's physical strength, but his guard went up at the thought of touching her-he wasn't sure he'd be able to control his desires in the face of that stimulus.

"When she's like this you couldn't move her with a lever." Ryoji's expression as he said this was suggestive; then he pointedly turned his face away from Kaoru, even as he seemed to be looking right through him. It was as if he knew Kaoru was interested in his mother as a woman, and was egging him on.

Look, I know you want to touch my Mom. It's okay. You have my permission. I'll even give you the opportunity.

Ryoji was provoking him, biting back laughter while he did it.

Kaoru wordlessly set up the extra bed. It wasn't so much that he was caving in to Ryoji's challenge as that he was eager to yield to whatever he felt on touching Reiko. If his feelings were going to deepen, let them. As yet he didn't understand the effect physical contact with her would have on his psychological state.

Kaoru placed his arms behind Reiko's neck and under her knees, and in one motion lifted her up and placed her on the bed.

As he laid her down, her lips brushed against his neck, just for a moment. She opened her eyes slightly and flexed her arms so as to hug him closer, then loosened her grip with a contented look on her face, and fell back to sleep.

Kaoru stayed silent and motionless for a little while, afraid she'd wake up if he moved. For several seconds, his body covered hers. With his face between her chest and belly, he could feel the resilience of the flesh of her abdomen; his eyes were trained on her face. He was looking up at her face from below, essentially. He could see the fine lines of her jaw, and above it the two black holes of her nostrils. He'd never seen her face from this angle before.

At length he stood up again. As he separated himself from her body, he asked himself, repeatedly: Am I falling in love with her?

The touch of her lips was still vivid on the skin of his neck.

"Well, then, I'll see you next week."

Kaoru put his hand hesitantly on the doorknob, so as not to reveal the pounding of his heart.

Ryoji still sat cross-legged on his bed, rocking back and forth, cracking his knuckles. Unlike a few moments ago, his face held no look of provocation or mockery now-he'd stifled all expression.

"Good night."

Kaoru slipped out of the room. He could feel Ryoji's unnatural smile fixed on the door as he shut it behind him.

Kaoru had a flash of intuition. This meeting was not mere coincidence. His future would be intimately tied with Reiko and Ryoji.

5

Among Kaoru's pleasures in life were his visits to the office of Assistant Professor Saiki in the Pathology Department. Saiki had been a classmate of his father's in this very university, and now, with his father in this unfortunate condition, Saiki was always ready to lend an ear or some advice. Officially, he wasn't Kaoru's advisor, but he was an old friend of the family, someone Kaoru had known since childhood.

These days there was a specific purpose to Kaoru's regular visits. Cells from the cancer torturing his father were being cultured in Saiki's lab, and Kaoru liked to come by to look at them under the microscope. To adequately fend off this enemy's attacks, he felt he needed to know its true visage.

Kaoru left the hospital proper and entered the building containing the Pathology, Forensic Medicine, and Microbiology laboratories. The university hospital was a motley collection of new and old buildings; this was one of the older ones. The Forensic Medicine classrooms were on the second floor, while the third housed Pathology, where he was headed.

He climbed the stairs and turned left into a hallway lined with small labs on either side. Kaoru stopped in front of Professor Saiki's door and knocked.

"Come in," Saiki called out. The door was open a crack; Kaoru stuck his head in. "Oh, it's you." This was Saiki's standard response on seeing Kaoru.

"Is this a bad time?"

"I'm busy, as you can see, but you're welcome to do what you like."

Saiki was involved in examining cells taken this afternoon from some diseased tissue; he barely looked up. That was fine with Kaoru; he'd rather be left alone to make his observations in freedom.

"Don't mind if I do, then."

Kaoru opened the door of the large refrigerator-like carbon dioxide incubator and searched for his father's cells. The incubator was kept at a constant temperature and a nearly constant level of carbon dioxide. It wouldn't do for him to keep the door open long.

But the plastic Petri dish in which his father's cells were being cultured was in its usual place, and he had no trouble finding it.

So this is what immortality looks like, he thought. It mystified him, as it always did.

His father's liver had been removed-having changed from its normal reddish-pink to a mottled hue covered with what looked like white powder-and was now sealed in a glass jar, preserved in formaldehyde, in another cabinet, where it had been stored for three years now. Sometimes it seemed to squirm or writhe, but maybe that was a trick of the light.

The liver was dead, of course, pickled in formaldehyde. Whereas the cancer cells in the Petri dish were alive.

The dish contained cells grown from Kaoru's father's cancer cells, cultured in a medium with a blood serum concentration of less than one percent.

With normal cells, growth stops when the growth factor in the blood serum is used up. And within a Petri dish, they won't multiply beyond a single layer no matter how much growth factor is added, due to what is called contact inhibition. Cancer cells not only lack contact inhibition, but they have an extremely low dependence on the blood serum. Simply put, they are able to grow and reproduce, layer upon layer, in a tiny space with virtually no food supply.

Normal cells in a Petri dish will only form one layer, whereas cancer cells will form layer upon layer. Normal cells reproduce in a flat, orderly fashion, while cancer cells multiply in a three-dimensional, disorderly manner. Normal cells have a natural limit to the number of times they can divide, while cancer cells can go on dividing forever.

Immortality.

Kaoru was fully aware of the irony in the fact that immortality, the object of man's deepest yearnings from time immemorial, was in the possession of this primeval horror, this killer of men.

As if to demonstrate their three-dimensional nature, his father's cancer cells had bubbled up into a spheroid. Every time Kaoru looked they had taken on a different shape. Originally, these had their source in normal cells in his father's liver, but now it might be more appropriate to see them as an independent life form. Even as their erstwhile host faced his crisis, these cells greedily enjoyed eternal life.

Kaoru set this dish full of concentrated contradiction into the phase contrast microscope. Its magnification only went up to x200, but it allowed easy colour imaging. He could only use the scanning electron microscope when he had time to spare.

The cancer cells, these life forms which had gone beyond any moderating influence, presented a peculiar sight. Perhaps there was something actually, objectively grotesque about their appearance, or perhaps they only looked grotesque to him because of his preconceptions about them as usurpers of human life.

Kaoru struggled to abandon this bias, his hatred of the agent of his father's suffering, as he observed the sample.

Raising the magnification, he could see that the cells were clumping together. The long, spindly, translucent cells grew as a thicket, stained a thin green. This wasn't their natural colour; the microscope had a green filter attached.

Normal cells would have been evenly distributed in a flat, orderly fashion, with no one part sticking out, but these cancer cells revealed, here and there, a thicker green shadow.

He could see them clearly: a multitude of points, bubbling up roundly, shining. These were cells in the process of dividing.

Kaoru changed the dish under the microscope several times, comparing the cancer cells to normal cells. The surface difference was readily apparent: the cancer cells displayed a chaotic filthiness.

But the surface of the cells was all he could examine: an optical microscope wasn't powerful enough to show him their nuclei or DNA.

Still, Kaoru gazed on untiring. His heart was heavy with the knowledge that he was wasting his time: just what was he going to learn looking at them from the outside? Still, even as he cursed himself for doing so, he examined the external part of each and every one of them.

The cells all looked alike on the surface. Thousands of identical faces, all in a row.

Identical faces.

Kaoru raised his face from the microscope.

Totally out of the blue, he had compared the cells to human faces. But that was what they looked like: the same face thousands of times over, gathering and sticking together in a clump until they formed a mottled mass.

Kaoru had to look away for a while.

That image came to me intuitively. Was it for a reason?

That was the first question to consider. His father had taught him to pay attention to his intuition.

It often happened that Kaoru would be reading a book or walking down the street and suddenly a completely unrelated scene would present itself to his mind's eye. Usually he didn't inquire into the reason. Say he was walking down the street and saw a movie star on a poster: he might suddenly remember an acquaintance who resembled the movie star. If he didn't register having seen the poster, which was entirely possible, it would seem as if the image of his acquaintance had come to him out of nowhere.

If it was a kind of synchronicity, then Kaoru wanted to analyze it to find out what had synched up with what. He'd been looking at cancer cells under x200 magnification, and something had been triggered so that the cells looked to him like human faces. Now: did that mean something?

Pondering it brought no answer, so Kaoru returned his gaze to the microscope. There had to be something which had elicited the comparison in his imagination. He saw narrow cells piled up in three dimensions. Little glowing globes. Kaoru muttered the same thing as before.

No doubt about it, they all have the same face.

Not only that, but it was clearly not a man's face, not to his imagination. If he had to choose he'd say it was somehow feminine. An egg-shaped, regular face, with smooth, even slippery, skin.

This was weird. In all the times he'd looked at cells through the phase contrast microscope, he'd never thought they looked like human faces.

6

Kaoru was in a hospital room face-to-face with Ryoji, but his mind was on the sounds coming from the bathroom. Reiko had been in there for some time, with the water running. She wasn't showering; maybe she was washing underwear. While tutoring Ryoji he'd seen Reiko hurriedly gathering up underwear that had been hung up to dry in the room.

Distractedly, Kaoru set about answering Ryoji's questions about his father's condition.

He gave him a brief rundown, but Ryoji's body language said he wanted to hear more. Maybe he wanted to sketch in the future of his own illness based on what he could learn of Kaoru's father's.

Kaoru stopped the conversation before Ryoji could start to guess that the cancer had spread to his father's lungs. Partly he hesitated because he thought the knowledge might have a negative influence on Ryoji, but partly he simply didn't want to say it out loud.

When the cancer had become heavy on his lungs, Hideyuki's face had started to betray weakness; he'd started to talk about what would happen after he was gone-to talk about entrusting Kaoru with his mother's care.

Look after Machi, okay?

At the sight of this weakness, Kaoru was seized with a desire to deliver the full force of his anger upon his father. And just how am I supposed to comfort Mom after you die, he wanted to say. Quit laying these impossible tasks on me!

Now as he sat talking about his father's condition with Ryoji, also lying flat in a hospital bed, his father's image came to him, and he had a hard time speaking. Not noticing that Kaoru had fallen silent, and insensitive to the reason why, Ryoji produced a forced-sounding laugh.

"Now that I think about it, Kaoru, I talked to your father once."

They'd both been in and out of the hospital with the same illness. No matter how big the hospital, it wasn't unlikely that they'd come into contact.

"Really?"

"He's the tall guy in 7B, right?"

"That's him."

"He's pretty strong. He's always frisky, slapping the nurses' butts and stuff like that."

That was Hideyuki alright. He'd achieved a certain notoriety among the patients for the cheerful way in which he battled his illness, never seeming to lose heart. They said that seeing him act so cheerful, so unafraid of death, made it possible for them to hang on to the hope necessary to gamble on long odds. He'd lost his stomach, his large intestine, and his liver, and now it looked like the cancer had spread to his lungs: his time, it appeared, had come. But regardless, in front of other people he put on a display of high spirits he couldn't possibly feel. The only exception was when he was alone with Kaoru: then he allowed his weak side to show…

"What about your Mom, Kaoru? How's she doing?" Ryoji asked, without much evident concern.

Reiko came out of the bathroom, spread the laundry out on the extra bed, and then disappeared back into the bathroom.

Kaoru followed her with his eyes, but the expected sound of running water never came. It seemed that Reiko just didn't want to be there. Maybe because the topic of Kaoru's mother had come up.

The Metastatic Human Cancer Virus can also be spread through contact with lymphocytes, the attending physician had said. Kaoru's first fears had been for his mother. He imagined they'd ceased sexual relations as soon as they'd been made aware of the risk, but there was a good chance she'd already contracted it by that point. Recently, Kaoru had finally been able to prevail on his mother to have her blood tested.

The results were positive. She had yet to manifest any symptoms, but it was a fact that the MHC virus had already attached itself to her DNA. In other words, the retrovirus's base sequence had been incorporated into the chromosomes in her cells.

At the moment, the process was paused at that step, but at any time her cells might begin to turn cancerous. In fact, there was every chance that it had already begun, and it just wasn't yet apparent on the surface.

The mechanism that determined when and how the provirus attached to the chromosomes would turn the cell cancerous was not yet understood, so the disease's progress from this point could not be predicted with any accuracy. But if it moved on to the next step, then his mother's cells would start producing new copies of the MHC virus.

Even if I get sick, I don't want to have surgery, she'd proclaimed, as soon as she'd heard the results. Since there was no way to head off metastasis, surgery was doomed from the start. All it could do was slow the progress of the disease, not cure it. After watching her husband suffer, she had a strong aversion to seeing her own body carved away piece by piece.

But what bothered Kaoru most was seeing his mother stray into mysticism, thinking that if modern medicine couldn't cure her, she'd try to find her own miracle elsewhere. The person she really wanted to save was not herself, although she knew she'd someday come down with cancer, but her husband, in the last stages of his.

With a passion that wouldn't blink at selling her soul to the devil, she started reading old writings on North American Indians. Her desk was stacked high with primary sources sent from who knew where.

The mythical world holds the key to a cure for cancer, she insisted, almost deliriously.

Again from the bathroom came the purposeful sound of running water. Ryoji reacted by glancing toward the bathroom.

"My mother's a carrier," said Kaoru in a low voice.

"Oh. So are you…?"

Ryoji asked his question with no emotion whatsoever, and Kaoru slowly shook his head. He'd had his blood tested two months ago, and the results had come back negative.

Hearing this, Ryoji actually laughed. Not necessarily out of relief that Kaoru was uninfected, though. Rather, it was a scornful, even pitying cackle. Kaoru glared at him.

"What's so funny about that?"

"I just feel sorry for you."

"For me?" Kaoru pointed at himself, and Ryoji nodded his head twice.

"Yeah. You're strong and healthy, so you're probably going to live a long time. Just thinking about it…"

Under his motorcycle-loving father's influence, Kaoru had taken up motocross, and under Hideyuki's tutelage he'd improved his showing with every race he'd entered. He'd grown up muscular and fit in a way that nobody could have predicted from a childhood spent on a computer from morning to night. Kaoru's muscles were visible even through his T-shirt, and yet this scrawny kid was pitying him. To Kaoru it sounded like he was laughing at something Kaoru had inherited from his father, and he fought back vigorously.

"Living's not as bad a thing as you seem to think it is."

Part of him could understand Ryoji's feelings, of course. Kaoru didn't know when or how he'd been infected, but here he was at age twelve- between surgery, chemotherapy, and repeated hospitalizations, his life had been nothing but an endless round of suffering. Kaoru could see why he'd want to generalize from his experience and believe that everybody must be feeling the same way.

"Yeah, but everybody dies." Ryoji turned his hollow gaze toward the ceiling. Kaoru no longer felt like arguing with him.

Death filled everything, everywhere. There in front of him was that bald little head. It was a solemn fact.

Nobody who hasn't experienced it can understand the misery of chemotherapy. Overcome with violent nausea, you lose your appetite, and anything you do manage to eat, you bring up again soon enough; you can't get any sleep. That was Ryoji's life, and that was how his life was going to end in the not-too-distant future. Kaoru knew it. What could he possibly say in the face of that?

Kaoru felt tired. Not physical fatigue. It was like his heart was blocked and screaming. He wanted to soar; he wanted to laugh, freely and from the heart. He wanted to spend time in close bodily contact with another human being.

"I never wanted to be born in the first place," Ryoji said, ignoring Kaoru's unresponsiveness. At that very moment, Reiko stepped out of the bathroom and into the reverberations of Ryoji's statement. Without the slightest change in her expression she crossed the room and went out into the hall.

Why did you have me? Perhaps she left because she couldn't bear her son's accusations, or perhaps she simply had an errand to run. There was no way of telling.

But Kaoru had been paying attention to her movements. And now two questions raised their heads. First of all, was Reiko infected with the MHC virus? And, second, by what route did Ryoji become infected with it? These were questions Kaoru couldn't come right out and ask, as they touched on private family matters.

"Well, I think I'll be on my way now." He couldn't be by Ryoji's side any longer. Plus, he wanted to follow Reiko.

Kaoru left the boy's bed and opened the door to the hallway. He wanted to come into closer contact with Reiko, both bodily and with what was inside her. Maybe his interest in her amounted to a kind of love; he couldn't tell. He felt that she was urging him out of the cramped hospital room and into the world outside.

Compelled by this stimulus, Kaoru wandered the long corridors of the hospital, looking for Reiko.

7

He had an idea where she was, or at least he thought he did.

My only peace these days comes from going to the very highest point in the hospital and looking out over the city.

A few evenings before, Kaoru had seen her standing outside the restaurant on the top floor of the hospital, nose pressed against a window, and he'd asked her what she was doing. She'd explained her actions with those words.

The sun would be setting soon, silhouetting the skyscrapers in this subcenter of the city, bringing them into beautiful relief. Kaoru knew that this was her favourite time of day for gazing at the city.

He got off the elevator on the seventeenth floor, and when he stepped into the hallway and looked left he could see a woman standing there, leaning against a pillar. Kaoru approached her without speaking, until they were standing side by side.

The setting sun streaked Reiko's face with crimson. Her cheeks glowed seductively as they reflected the sky's shifting hues.

She knew as soon as he came up to her; she could see his reflection in the glass. She addressed his reflection with a faint smile.

"I'm sorry."

Kaoru couldn't figure out what she was apologizing for. Maybe she was recognizing his skill in tutoring her difficult-to-deal-with son, but in that case a thank-you would have been more appropriate. Kaoru was embarrassed for a response.

He decided not to ask why she'd apologized. "You really like high places, don't you?"

"I do. Maybe it's because I've lived my whole life hugging the ground."

Did she mean she'd always lived in one-story houses? If so, it was a stark contrast to Kaoru's own living environment. He still lived with his mother in their apartment tower overlooking Tokyo Bay.

Reiko changed the subject in an effort to dispel the oppressive atmosphere; in an enthusiastic voice she started talking about dreams. She started right in, like a shot, with what she wanted to do first when her son had recovered from his illness. The precondition itself-her son recovering-being utterly impossible, she was free to dream whatever unrealistic dreams she felt like. Among the more realistic ideas she mentioned was taking a trip overseas.

So when she changed tack and asked Kaoru, "What's your dream?" he was able without hesitation to come up with the family trip to the North American desert that they'd planned ten years ago.

Kaoru gave Reiko a brief account of what they'd talked about that late night ten years ago- the relationship between gravity and life, the mysteries of life itself, and how those led to the possible existence of longevity zones.

He then explained in simple terms how his father's promise to take him to the desert had fuelled further interest in global longevity patterns. Then came his father's cancer, which had prompted him to deeper research, and the belief that there had to be a relationship between longevity zones and the number of cancer victims.

This last point piqued Reiko's interest, and, still leaning against the glass, she turned to face Kaoru.

"What kind of relationship?"

"I'm not entirely sure yet, but the statistics show certain peculiarities that can't be ignored."

Kaoru warmed up to his explanation, as he could see that Reiko had pricked up her ears.

"It was not just coincidence that led me that night into associating gravitational anomalies with longevity. I had a flash of intuition. Most scientific discoveries are the result of intuition. Inspiration comes first, then reason. It might not be far off to think that I was responding to some kind of suggestion that night.

"When my father's cancer spread to his liver, I started researching longevity zones worldwide. It wasn't just my imagination. It's been confirmed: there are spots on the globe where people live longer. I analyzed all kinds of data. If they had something in common, I was going to find it.

"I finally narrowed it down to four particularly well-known longevity zones: Abkhazia, an area of the Caucasus on the shores of the Black Sea; Vilcabamba, a sacred valley on the border between Peru and Ecuador; Hunza, a mountainous region surrounded by the Karakoram Mountains and the Hindukush and cut off from the surrounding area; and Sanaru Island, in the Samejima archipelago of Japan. I wasn't able to visit these places myself to investigate, so I read everything I could get my hands on that related to them, and compiled my own statistics. When I did that, one thing stood out. It's a bit too early for me to make a definitive judgment, but it would seem that these places have not seen a single death from cancer. Doctors and biologists from around the world have investigated longevity zones, and they've left countless reports. None of them record deaths from cancer.

"The reports all agree in pointing to diet as a possible cause for this low cancer rate. But this is nothing more than a guess, seeing as how we haven't yet fully explained the mechanism that produces cancer. There's no denying that people in these areas live on a simple diet consisting mainly of vegetables and grains, but data suggests that their consumption of tobacco and alcohol may even be higher than other areas. At the very least, we aren't able to say that their exposure to carcinogens is lower than normal.

"All of this makes me wonder. Why is it that these longevity zones have so few people suffering from cancer? And then… Listen to this. Cancer cells have the ability to make normal cells immortal. Is that somehow related? And how are we to account for the fact that these longevity zones match up perfectly with areas of unusually low gravity?

"There's got to be a satisfying explanation, but I haven't been able to come up with it yet."

Kaoru paused for breath. His excitement had risen to a peculiar pitch as he talked.

Reiko was silent for a time, looking at Kaoru. Then she licked her lips and spoke.

"This MHC virus that's suddenly everywhere- where did it come from?"

Her question struck Kaoru as beside the point.

"Why ask me?"

Reiko's eyes were open wide and her expression was serious: she evidently really wanted an answer. At that moment Kaoru found her unbearably adorable. He forgot all about the fact that she was ten years older than he; he wanted to place his hands gently on her cheeks and draw her to him.

"Don't laugh. It's just that I wondered, for a second, if the MHC virus might just possibly have come from one of these longevity zones of yours."

Kaoru could guess at her train of thought. He'd read a novel once about someone whose entire body had been overrun by cancer; only, instead of dying, the cancer had made him immortal.

Maybe people in those areas have learned to coexist with cancer, and that's why they live so long. Most likely Reiko's imagination had moved along those lines. Maybe it's not that those areas are free of cancer. Maybe they're full of it, in fact. Maybe it's just that nobody dies from it. Maybe the cancer virus started there…

"Maybe a virus somehow picked up these people's cancer chromosome and the result escaped into the world as the Metastatic Human Cancer Virus. Is that what you're saying?"

"It's all much too difficult for me to understand, I'm sure. It was just a thought. Forget about it."

Reiko turned her gaze to the world below. Over the last few minutes the sky had changed colour dramatically, and that change was reflected even more vividly in Reiko's expression. Deep shadows pooled in the hollows of her eye sockets. The darker it got outside, the more the window began to function as a mirror. Against the backdrop of skyscrapers Kaoru saw Reiko's face reflected in the glass as if it was floating disembodied in the darkness.

"Metastatic cancer victims are especially numerous in Japan and America."

It was true: the geographical distribution of the victims showed marked variation. Japan and America each had roughly a million patients with the disease, and the advanced nations of Europe had several hundred thousand, while remote areas of the type where the longevity zones were located had hardly reported any cases at all. Kaoru was trying to imply that her hypothesis had holes.

"What about the desert area you mentioned, in North America? It has abnormally low gravity, so it wouldn't be surprising if people there lived longer, would it?"

"It's just a guess."

"So you have no proof."

"I suppose you could say all this has just been a game for me."

The word seemed to come as a shock to Reiko: she became visibly discouraged. "Oh." Now her discouragement turned into a frown; she made as if to turn away from Kaoru.

"What's wrong?"

Kaoru was a bit taken aback by this sudden change in her.

"I was hoping for a miracle. It's all we have left," she said, still looking away.

A miracle, Kaoru thought in disgust. Reiko was about to fall into the same trap as his mother.

"I think you'd better stop hoping for a miracle."

"I won't stop."

"You have other things you need to be doing."

He wanted Reiko to keep her wits about her. But she wasn't listening to him now.

"I was just thinking, maybe all the inhabitants of those longevity zones get viral cancer at some point. But before the cancer cells incapacitate their internal organs, some factor turns their cells immortal, and the cancer becomes benign. It’s bad side disappears, and the cancer is able to coexist with human beings. Their cells are able to undergo mitosis more times, with the result that they live longer. How's that for a theory?"

He'd never seen Reiko go on like this before. She wasn't making reason the arbiter of truth and falsehood anymore: she was judging subjectively, based on how much hope the result would allow her. You could find two or three pieces of evidence to support any hypothesis if you allowed your judgment to be swayed by your desire for a particular result, Kaoru knew. This wasn't going to help her son. He understood the desire to cling to a god. But how was he to deal with her clinging to what she knew was nothing more than idle speculation? It might make for good fiction, but Kaoru didn't have time to take such fancies seriously if he wanted to make it as a doctor.

For her part, Reiko was prepared to believe in her imagined world with all her might. Kaoru knew he'd sown the seeds for this. He wished he'd never mentioned any of it.

"Please, just forget everything I told you."

"No way. I can't. That place you were trying to get to has something, some factor that can eliminate cancer's negative properties, that can change it from something malignant to something benign."

Kaoru held up his hands as if to calm her down, but to no avail. She was more enthused than he'd ever seen her.

"I think you need to go there after all-you need to get your hands on whatever it is that can turn death into life."

"Now hold on a minute."

Her face was close to his now, and she'd grabbed hold of his hand.

"Please!" The soft touch of her hand reinforced the message.

"I'm tired of living like this. Ryoji's going to start his fourth round of chemotherapy soon."

"I'm sure that's tough on you."

"I'd go with you if I could."

In that moment, what had started out as a family trip suddenly turned into something different. Imagining a journey to the North American desert alone with Reiko made Kaoru feel hot inside. That low-gravity point at the Four Corners area-it felt like a deep crevice, a vortex, sucking everything in. He was being pulled in by low gravity… No, at this moment Kaoru was being pulled in by this pair of eyes right in front of him.

She wore no makeup except for a very little lipstick, and she gave off a perfume that seemed to be the natural scent of her skin. Kaoru and Reiko were enveloped in the shadows where the fluorescent lights of the hallway were blocked by a large pillar. The window was now a perfect mirror, reflecting the occasional passerby in the corridor.

Before he knew what was happening, Kaoru was returning her grip on his hands. Hand toyed with hand, fingers intertwined with fingers, and eyes checked each other's intentions.

The last sound of footsteps disappeared from the hallway, and as if they'd been gauging the moment when silence would grace them, they drew each other close in an embrace. They seized the moment when the seventeenth-floor corridor was empty.

Arms encircled backs in embrace, body communicated to body the pulsating of blood vessels. The individual rhythms of their blood synchronized, cells were stimulated through thin cloth layers. Kaoru became erect, his swelling pressing against Reiko's midriff.

Kaoru needed her lips, so he pulled his head back and tried to turn her face up towards his; Reiko didn't respond, but only dug her fingers deeper into his back. She pressed her forehead into his jaw and forced his head sideways-she seemed to be actively rejecting his kiss. After several tries and several rebuffs, Kaoru finally understood.

She's infected too.

The MHC virus was known to have been transmitted via saliva. Reiko must be rejecting him out of fear for his safety. He began to understand her unexplained course of action that evening. Earlier, when Ryoji had said, "I never wanted to be born in the first place," she'd left the room without a word. Maybe Ryoji had been infected while still in his mother's womb. He'd finally let these recriminating words escape, and she'd found she couldn't bear to remain.

However, the fear of infection did nothing to cool Kaoru's ardor. He gently parted his body from hers, cradled her cheeks in his hands, pleaded to her with his eyes that he'd understood the situation, and then placed his lips on hers in a way that brooked no refusal.

This time, Reiko didn't even try to reject him.

He placed one hand on the back of her neck, the other on her bottom, and pulled her toward him. Such was the force of their coming together that their teeth collided softly, with a lascivious sound composed equally of the softness of lips, the hardness of teeth, and saliva.

They pressed their mouths together until they'd sucked out all their breath and could no longer sustain the intensity. Then their lips parted and they touched cheek to cheek, listening to each other's tortuous gasps. Reiko stretched up to her full height so she could bring her lips close to Kaoru's ear.

"Please," she said, between ragged breaths.

He couldn't tell if the vibrations at his ear were gasps or sobs.

Reiko wanted to save not only her son, but herself.

"Please… help."

"I'm not God."

It was all Kaoru could do to say that much. The only thing he understood clearly at this moment, with his organ engorged with blood and his mind not behaving rationally, was that he had taken his own first steps into Death's territory. He felt no confusion, no regret over having obeyed his body's commands and held Reiko and kissed her. He felt that no matter how many chances he had to live this moment over, he would always make the same choices. Reiko's body emanated a power that could not be opposed.

"Please. I know you'll go there."

Now even Reiko was spurring him on to visit the low-gravity zone. The fiction whose seed he himself had planted, to which Reiko had given form, was now taking root within Kaoru.

8

As Kaoru entered his father's hospital room, he found Professor Saiki just getting up from the chair by his father's bed.

"Hey," Saiki said on seeing Kaoru. He raised a hand and made as if to leave the room.

"That's alright, stay a while." If he was leaving because he felt bad about disrupting Kaoru's visit with his father, then Kaoru felt a duty to press him to stay.

"I can't. As you know, I'm quite busy." And it didn't seem like mere politeness: Saiki was twitching as if he did indeed have pressing business.

"Oh. Well, then."

"That's right. I just popped in by special request," Saiki said, glancing at Hideyuki. Then he raised his hand again, said, "Later, then," and left. Kaoru watched him walk away, then went to his father's side.

"How are you feeling, Dad?"

Kaoru gazed down at his father for a moment, studying his color and the set of his jaw, before taking Saiki's place in the chair.

"Annoyed," Hideyuki said in a monotone, eyes raised to the ceiling.

"What happened?".

"Saiki. He brings nothing but bad news."

Saiki was an old classmate from med school, but as he'd elected to go into research rather than clinical medicine, he wasn't directly involved in Hideyuki's case. Which made Kaoru wonder all the more what sort of bad news he could have been bringing.

"What do you mean?"

"Do you know Masato Nakamura?"

Hideyuki's voice was hoarse.

"One of your friends, right?"

Kaoru recognized the name Nakamura. He'd been a coworker of Hideyuki's on the Loop project; Kaoru believed he was currently a professor in the engineering department of a provincial university.

"He's dead," said Hideyuki, curtly.

"Really?"

"He had the same illness as me."

Kaoru had heard people say that when someone your own age dies it invariably comes as a shock, making you feel it might be your turn next.

"You're still alright, Dad."

Kaoru couldn't think of anything to say that didn't sound commonplace. Hideyuki slowly shook his head where he lay, as if to say that meaningless words of encouragement wouldn't do him any good.

"Do you know Komatsuzaki?"

"No." Kaoru had never heard this name.

"He joined the Loop project after me."

"Oh?"

"He's dead, too."

Kaoru swallowed hard. Death's shadow was creeping ever closer to his father.

Hideyuki proceeded to list three more names, summing up with a simple "They're all dead."

"Doesn't it make you wonder what's going on?" he continued. "All those names I mentioned belonged to people I worked with on the artificial life project, or who were at least connected with it in some way."

"And all of them died from MHC?"

"How many people in Japan have been infected with this virus?"

"About a million, maybe?" That included people like Reiko and Kaoru's mother who had been infected but hadn't yet gotten sick.

"That's a whole lot, but it's still no more than one percent of the population. Whereas, me, I don't know anybody who's not infected."

Hideyuki cast a sharp glance at Kaoru; at first he seemed to be searching Kaoru's soul, but then his expression relaxed into one of prayer.

"You're okay, right?"

Hideyuki brought a hand out from under his sheet and touched Kaoru's knee through his jeans. No doubt he wanted to hold his son's hand, but was afraid of skin-on-skin contact. With his wife already infected, all it would take to rob Hideyuki of the will to fight the cancer would be knowing that Kaoru had contracted the virus too.

Kaoru averted his eyes from his father's weakening gaze.

"Were there any problems with the test results?"

Kaoru felt like his father could look right through him, but he forced himself to speak through his fear. "I told you there's nothing to worry about." True, two months ago his test results had been negative, but there was no telling what next month's test would reveal.

Kaoru turned away, pretending to be reacting to the sound of footsteps in the corridor. He flashed back to the scene in Ryoji's room yesterday afternoon; the mental images brought with them stirrings of the blood and of the flesh, resurrecting the sensory fluctuations that had rocked his body.

The evening before last, he'd been forced to limit his contact with Reiko to kissing. They'd been in a hallway, and they'd only been vouchsafed a few minutes. Considering they were in a hospital, it was about as much as they had any right to hope for.

The next afternoon-yesterday-he'd gone back to Ryoji's sickroom to retrieve the pathology textbook he'd left there, and he arrived just after Ryoji had been taken off to Radiology for some tests. Kaoru hadn't known it was time for his tests; Reiko hadn't told him. But to all appearances it looked as if he'd timed his visit to coincide with the boy's absence.

He knocked softly, and immediately Reiko opened the door, but just a crack. Her face was wet and she was holding a towel-she must have been washing her face when he knocked. There was a sink next to the door, and the ten-watt fluorescent bulb above it was lit. She'd been taking off her makeup there, rather than in the bathroom.

Patting her face with the towel, she spoke in a quiet, controlled voice.

"You forgot something yesterday."

"Sorry, I should have called first." Kaoru lowered his voice in response. There was no sign of Ryoji.

"Come in."

She took his hand and guided him into the room, then shut the door. They stood in front of the sink, in front of the mirror, facing each other. She finished wiping her face. She was letting Kaoru see her features unadorned by cosmetics.

There were crows' feet around her eyes, appropriate to her age, but they only made her look more attractive to him.

A partition stood between them and Ryoji's empty bed; Kaoru nodded toward it, as if to ask why he wasn't in it.

"The nurse just took him away."

"Tests?"

"Yes."

"What kind?" "

"A scintigram," she said in a shaky tone that suggested she was unfamiliar with the word.

A scintigram, a precursor to chemotherapy, took two hours at a minimum, since it involved injecting a contrast medium into the subject's veins. Nobody would be coming in until the test was finished. For that brief interval, Reiko and Kaoru had been left with a private room all to themselves.

With Ryoji's test regimen reaching this point, Reiko found herself face to face with the prospect of her son entering chemotherapy. She was dejected. A bitter battle was beginning. Anti-cancer drugs harm normal cells in the process of attacking cancer cells. She knew she'd have to watch her son suffer from lethargy, loss of appetite, nausea, and the prospect hurt her more than anything, especially as she knew that his enduring this suffering wouldn't guarantee the extinction of his cancer cells. All it would do would be to slow their rate of reproduction, and thereby delay the final moments. This cancer was destined to metastasize, and there was no way to prevent it.

Kaoru didn't know what to say to this mother whose son had been taken away from her. Platitudes would only make it worse.

But Reiko looked him in the eye and said, "The miracle will come if we wait for it."

She enfolded Kaoru's hands in hers; it seemed to be a habit of hers.

"I just don't know."

"I'm sick and tired of living like this."

"Me, too."

"Well, do something! Please! Help us! I know you can."

Like I can do anything! Kaoru felt like screaming, but managed to keep himself from saying anything.

Reiko's bangs were still wet and several strands clung to her forehead. Beneath them her eyes were moist and pleading. Her mouth quivered as if she might break out into sobs at any moment; Kaoru's heart went out to her. If only he could help. He wanted to, badly. He couldn't stand by helplessly and watch this magnificent body laid low.

The faucet next to them hadn't been shut off all the way-a little trickle of water came out of it. The sound filled the room and stimulated his desire. The noise of the water itself was what urged him into action.

Reiko looked at the faucet, and tried to free one hand to turn it off. But Kaoru only gripped her hand tighter, pulling her toward him with great force.

At first she made as if to resist, a complex series of emotions clouding her features. Conflicting feelings raged within her-Kaoru knew this by the touch of her skin. Her obligations as a mother, and her desires as a woman.

Still holding her to him, he shifted positions and tried to lay her down on the bed. But she resisted slightly, so that she ended up sitting on the floor with her back pushed up against the edge of the bed.

Pinned against a sickbed missing its owner, hunched over with death a burden on her shoulders, Reiko tried to confront the sexual impulses pressing in on her. The spectre of death was assaulting her from everywhere, except the direction from which lust came, boiling up as if to prove that she was still alive. Then she thought of how her son at this very moment was undergoing cruel tests, and the knowledge enervated her desire. Her maternal instincts began to crowd out her sexual needs.

But not Kaoru. He was beyond reining in now, as his mind and body came together in pursuit of a single goal.

He didn't care that Reiko was infected with MHC. He was aware of the data showing that the virus spread even more easily through genital contact than oral, but for the moment that knowledge was clean gone from him.

He sat down next to her, intertwined with her, on the floor of the sickroom. He placed his mouth over hers, nimbly undid the buttons of her blouse. These bold, play boyish actions surprised even him: he was relatively inexperienced at romance.

While Kaoru basked in his memories of the previous afternoon, Hideyuki obstinately hammered away on the dangers of exposing oneself to the virus.

… Your blood test came back negative? … I was your age once-you 've got to be careful with women… You can't let yourself get careless… Don't give in to momentary temptation…

The words went right over Kaoru's head. He couldn't look his father in the eye. The pure, simple act of loving a woman had become a betrayal of his father's expectations.

"Hey, kiddo! Are you listening to me?"

Hideyuki threw a monkey wrench into the workings of Kaoru's reverie. It had been ages since he'd called Kaoru "kiddo". Kaoru gradually let himself be pulled back to the present moment.

"Don't worry, I said."

Hideyuki still showed no signs of softening his suspicious gaze.

They stared at each other in silence for a while.

They exchanged more information that way than they'd been able to communicate in words. Then Hideyuki reached out and touched Kaoru's knee once more.

"Don't you get it? You're my greatest treasure."

Kaoru placed his hand over his father's.

"I know, Dad."

"I don't want you giving in to this. You've got to fight it. You've got to concentrate all your intelligence on confronting this enemy that wants to destroy your body, your youth."

Reiko was imploring him to help; his father was ordering him to fight. He felt pressure from both sides. But if he had been infected with MHC, if he was at risk of developing metastatic cancer, then those imperatives would cease to be things external to him. He'd have to rouse himself to action in order to protect his own body.

Hideyuki returned to his previous topic. "When Saiki was here he was telling me how all my old colleagues were succumbing to this disease, one after the other, and it struck me. I know a lot of cancer victims."

"I guess so," Kaoru grunted. He, too, knew a lot of carriers of the MHC virus.

"Maybe there's a reason."

"Like, maybe researchers are particularly susceptible?"

"This should be right up your alley. You're the one who ferreted out those longevity zones from the gravitational anomaly map. Listen to me. I want you to make a distribution map of people with MHC in Japan and America. Or a breakdown of infected people by occupation. Anyway, just gather all the data you can and come up with some statistics."

"Okay. I'll give it a try."

"I've got a feeling about this. I don't think it's a coincidence that we have so much sickness around us."

Still looking up at the ceiling, Hideyuki stretched his hand out to the sideboard and groped around as if searching for something. Kaoru noticed a stack of printed matter there, dozens of pages. He picked them up first and showed them to his father. "Is this what you're looking for?"

The first page contained the following sequence of letters:

10 20

AATGCTACTACTATTAGTAGAATTGATGC

30 40 50

CACCTTTTCAGCTCGCGCCCCA…

Kaoru recognized it at a glance: it was a chromosomal base sequence. "Saiki left those."

"What chromosomes was he analyzing?" "This, of course," Hideyuki said, tapping his own chest. Now that the daily wash of tests was suggesting that the cancer had spread to his lungs, all he had to do to indicate the cancer virus was to point, with contempt, at his chest.

This is the complete base sequence of the Metastatic Human Cancer Virus.

Moved, Kaoru looked at the sequence of letters again. The dozens of pages he held in his hands contained the base sequences for nine genes; they held thousands, even tens of millions of letters; they held the blueprint for the virus that bedeviled them.

9

First off, Kaoru decided to visit the lab that maintained the massive memory banks of the Loop. The history of the imaginary universe known as the Loop was stored in 620 terabytes of holographic memory; even now, twenty years later, it was safe and sound.

To get to the lab, it was faster to take the New Line than the old subway system. Kaoru left the university hospital and headed for the station.

He only walked for a few minutes, but by the time he boarded, his T-shirt was wet with perspiration. It being early afternoon, there were few passengers. As a result, the air conditioning cooled the air a little too efficiently for Kaoru. In no time, his T-shirt felt clammy and cold against his skin.

He had a seat and took from his briefcase the stack of printouts he'd just gotten from his father, containing the entire base sequence of the MHC virus. The sequence consisted of the letters A, T, G, and C, representing the different varieties of nucleotides. He could, he knew, stare at it forever and it still wouldn't get him anywhere in particular. But he had nothing to do. If he'd had a paperback he'd be idly flipping through it right about now, but as it happened his briefcase contained nothing else to pass the time with.

A gene is essentially a unit of information, and the MHC virus had a mere nine of them. By way of comparison, a human being has something like 300,000 genes-so the virus's total was fairly small.

Each gene can be represented by a sequence of a few thousand to a few hundred thousand bases; three bases form one amino acid. So, for example, a string of three thousand letters (ATGC… and so on) means that a thousand amino acids have all joined hands to create a protein.

Kaoru scrutinized page after page, and when his eyes got tired he lifted his head and gazed out the window at the scenery. The print was so small that trying to focus on it through the jostling of the train was making him queasy. Above each row of letters was a series of numbers in multiples of ten, allowing the viewer to tell at a glance what number in the sequence each letter was.

By scanning these numbers it was an easy matter to figure out how many bases constituted each of the nine genes. They ranged from a few thousand to hundreds of thousands. In order, they were:

Gene #1: 3072 bases

Gene #2: 393,216 bases

Gene #3: 12,288 bases

Gene #4: 786,432 bases

Gene #5: 24,576 bases

Gene #6: 49,152 bases

Gene #7: 196,608 bases

Gene #8: 6144 bases

Gene #9: 98,304 bases

Kaoru stood up and moved over to the door. The breeze from the air conditioner had been hitting him on the left side of his body. He especially disliked this kind of unnatural chill; if the cost of sitting was freezing, he'd just as soon stand.

As he leaned against the door he idly pictured Reiko's face. But visions of his father's attenuated features kept coming to mind.

The research centre where he was headed was a partial leftover of the place where his father had once worked. Kaoru knew that twenty-five years ago, upon finishing his doctorate, his father had been invited to join the Loop project, and that his father had devoted the next five years to researching artificial life. He didn't, however, know the specifics of what his father had been researching. It had all been before Kaoru was born.

Every time he tried to ask, his father became close-mouthed. But the project hadn't ended well: that much Kaoru had been able to guess. Hideyuki was the type to jump up and down and celebrate when his work was successful, but he'd clamp his mouth shut tight in the wake of failure. Once Kaoru recognized the signs, he realized it wouldn't do to keep rooting around.

But this time-maybe it was his age, or maybe his illness had softened him-when Kaoru had made to leave his father's sickroom with the sheaf of papers in his hand, Hideyuki had stopped him with a word.

"Kiddo."

Then his father, on his own initiative, had brought up the topic of his research some two decades before.

"My area was to come up with a computer simulation of the emergence of life."

His explanation was simple: for years it had been his dream to elucidate how life had first appeared on earth. But, as Kaoru had guessed, the experiment had come to an unforeseen conclusion, and it had been put on ice. His father didn't use the word "failed". As far as he was concerned, the experiment as an experiment could be considered a resounding success. But he still couldn't figure out why it had come out the way it had.

"The Loop… well, you might say it turned cancerous."

By which he meant that all the patterns in the program had been assimilated into one set pattern: all diversity vanished, and the program ground to a halt.

To Kaoru it sounded like his father was rambling. He didn't know what to make of all this. And it was no wonder: he knew nothing about the project's methodology, and he couldn't see it as a whole.

But he did have a desire, first of all, to understand what it was his dad had been working on. And, second, he wanted to find out whether or not it was a coincidence that most of his father's colleagues from the lab had died from the MHC virus.

So it had been Kaoru's idea to visit the research centre. His father had given him the name of a surviving colleague and done what he could to ensure that the visit went smoothly.

Word from his father would doubtless have reached somebody at the research centre by now. Kaoru had every expectation that he'd be received courteously.

He glanced down at the paper again.

There was something about the total number of bases in each gene that was tugging at him.

The top page held nine numbers, ranging from four to six digits, each number representing the bases in one gene.

3072

393,216

12,288

786,432

24,576

49,152

196,608

6144

98,304

Kaoru had a special ability when it came to numbers; it was this ability that was sending up a red flag now. But he couldn't put his finger on exactly why. He felt like there was something these numbers had in common. Yes, he was sure of it. His intuition on that point was strong.

To clear his mind he gazed at the scenery outside the window. On both sides of the tracks tall buildings clustered; the streamlined train threaded its way between them silently.

The train slowed down as it approached a platform. He saw a building under construction, and beyond it another painted in bright primary colours.

The station was in a cluster of four skyscrapers, each a thousand feet tall, organically connected into a single city-within-a-city. It had an English name; everybody knew it.

The Square Building.

"Square." He knew what it meant: a quadrilateral with each side the same length. But it had another meaning, as well.

Kaoru looked down again at the printout, concentrating on the nine numbers.

"It couldn't be," he murmured. He recalled that the English word "square" also referred to the process of multiplying a number by itself. And with that, it came to him.

3072 = 2(10) X 3

393,216 = 2(17) X 3

12,288 = 2(12) X 3

786,432 = 2(18) X 3

24,576 = 2(13) X 3

49,152 = 2(14) X 3

196,608 = 2(16) X 3

6144 = 2(11) X 3

98,304 = 2(15) X 3

It was astonishing: each number equalled two to the power of n times three.

Kaoru made some quick mental calculations as to the probability of nine random four to six digit numbers all turning out to equal 2n x 3. There were only eighteen such numbers in all the possible figures up to six digits.

Kaoru didn't need to come up with the exact probability, though: it was breathtakingly close to zero.

Why do this virus's gene sequences come out to 2n x 3?

The chances of it happening were basically zero, and yet it had happened. These nine numbers had surmounted that wall of improbability. It couldn't be a coincidence. He had to proceed under the assumption that it meant something.

He could remember coming to the same conclusion during that debate with his father ten years ago. That time the topic had been the emergence of life. Oh, and superstitions, jinxes… It was best to think that behind every amazing coincidence was some entity pulling strings.

An announcement came on to say that the train had reached Kaoru's station. The voice sounded to Kaoru like it was coming from far, far away.

Kaoru was expelled from the train doors onto the platform. If his father was to be believed, it was only a ten minutes' walk from the station to the research centre.

Kaoru wandered the hot platform, looking like an apparition. The sudden transition from the chilled train interior to the oppressive heat outside had left him tired.

He placed the stack of papers back into his briefcase and followed his father's directions to the research centre.

10

The centre was indeed not far from the station, but the road was hilly, and by the time Kaoru arrived he was drenched in sweat again. He stood in front of an old-fashioned building behind an embassy and compared the address to what he'd written down. No mistake. The fourth and fifth floors of this building held the laboratory maintaining the Loop data.

Kaoru took the elevator to the fourth floor, where he asked the receptionist to page a Mr Amano. This was the name Hideyuki had given him.

When you get to the lab, have them page a guy named Amano. I'll let him know you're coming.

Hideyuki had stressed this step a number of times.

The woman at the desk picked up her intercom receiver. "There's a Mr Kaoru Futami to see you, sir." Then she smiled at Kaoru and indicated a couch in the hall. "He'll be with you in a few moments."

Kaoru had a seat and waited for Amano to show up. While he waited he surveyed the place, taking in the fact that this was where his father had worked before Kaoru was born. Had he walked past this very reception desk every morning on his way to his lab?

"Sorry to keep you waiting."

The voice came from a completely unexpected direction. Kaoru had been expecting Amano to appear from the main section of the floor, behind the receptionist, but instead he approached Kaoru from the elevator landing. Kaoru stood and bowed slightly.

"Pleased to meet you. I'm Kaoru Futami. My father's always saying how much in your debt he is."

"Not at all, not at all. I'm in his debt, actually."

Amano took a business card from his card case and handed it to Kaoru. As a mere medical student, Kaoru of course didn't carry business cards, so he had to take Amano's without offering one in return.

Beneath the name of the research centre was the man's title, Professor of Medicine, and his name: Toru Amano.

Kaoru was puzzled to find a medical professor in what seemed to be a computer research centre. But come to think of it, his own father had a medical background. Perhaps it wasn't so surprising after all.

"What's your specialty, if I might ask?"

Amano smiled, showing the dimples in his cheeks. "Microbiology."

He was a small, slender man. He'd been junior to Kaoru's father by two years, so he had to be in his late forties, but he certainly didn't look that old. He could easily have passed for mid-thirties.

"Well, I know you must be busy, so…"

"It's nothing. Why don't I show you around?"

Amano guided Kaoru to the elevator and pushed the UP button.

The upper floor had a similar reception area; Amano led Kaoru past it without stopping.

He brought him to a large private room. Two walls were filled entirely with books, and several computers sat on the desk.

Amano sank into his chair, motioning Kaoru toward the chair for guests.

"I'm told you'd like a detailed explanation of Dr Hideyuki Futami's research."

"That's correct."

"How is he, by the way? How's his health holding up?" It didn't appear that Amano was just asking to be polite: he seemed sincerely worried. If it was proven that the cancer had spread to Hideyuki's lungs, the situation would be essentially hopeless, but Kaoru glossed over that.

"About as well as can be expected."

"He taught me quite a lot, you know." Amano got a look of nostalgia on his face and continued. "Things have changed these last few years. It's gotten… quiet."

Kaoru assumed he meant the research centre. Now that he thought about it, he hadn't seen anybody here besides the receptionist and Amano. He suspected the reason had something to do with the virus.

"My father told me that many of you who participated in the Loop research have died of cancer."

"Very many indeed."

"Is there a specific reason?"

"Well, I don't believe there's been any statement to that effect."

Kaoru couldn't believe it was a mere coincidence, though, and if some kind of cause-and-effect relationship could be established, it would be epochal. It might lead to the discovery of a new way of treating viral cancer.

"Do you know where the first victim was discovered?" As a microbiologist, Amano should know a lot about that sort of thing.

"It's been hard to get exact data, because it's hard to distinguish it from previous varieties of cancer, but the MHC virus was first discovered in an American patient."

Kaoru had heard rumours to that effect, that America had been the birthplace of the disease.

"Where in America?"

"The victim was a computer technician living in Albuquerque, New Mexico."

Amano frowned, as if he'd just noticed the curious commonality. The MHC virus had been first discovered in the body of a computer technician. The infection rate among researchers at this facility, a computer-research centre, was much higher than average. Of course, it wasn't totally beyond the realm of coincidence, but…

Amano's frown only lasted an instant. The coincidence struck him, but he immediately decided it wasn't worth assigning a special explanation to, and so he erased the frown.

And then he stood up quickly, as if in confirmation of what Kaoru guessed to be his thought process.

"Oh, yes. There's an old, old videotape you might like to take a look at."

"A videotape?" Kaoru felt himself tense up; he didn't know why.

"It's something Futami-sensei's staff put together. A sort of introduction to their research aims and methods. Part of their job was to elicit budgetary contributions from various sources. The video was just a promotional tool, but it's the best and quickest explanation of the purpose behind the Loop."

Amano went through the door first, urging Kaoru to follow. "This way, please."

The hallway snaked through several turns as it led through the complex of laboratories. Finally, Amano showed Kaoru into what looked like a reception room. It had a table and sofas.

There were no windows; the room had to be in the middle of the building. The furnishings put Kaoru in mind of an art gallery-framed pictures adorned the walls.

What was strange was that there was exactly one picture on each wall, at exactly the same height, at exactly the same distance from the corners, in exactly the same size frame-as if they were icons hung to keep away evil spirits or something. Each frame contained a modernist painting incorporating photography.

Kaoru's eyes were riveted to the pictures. They seemed to have captured in photographs some rectangular piece of modern art from four sides and then distorted it; as he looked around the room he got the feeling that he was inside some kind of angular construction. Modern art objects usually gave a cold, hard impression. And what about the aesthetic sense that had placed, not the object itself, but pictures of it at the same point on all four walls? It was as if the fact that they were pictures was emphasizing a certain obsessiveness.

Kaoru looked closely at one of the pictures to see if he could make out the name of the artist. There was a signature, a foreign name, but it was hard to make out. A "C…" and an "Eliot…" "Please. Have a seat."

At the sound of Amano's voice behind him, Kaoru remembered where he was. He sat on the couch to which Amano was pointing, and noticed a 32-inch television facing him. Amano must have pulled it out of the cabinet while he wasn't looking.

Amano opened another cabinet and took out a videotape. The tape had a label on its spine, and the label had a title written on it in large characters.

LOOP

There was no way he could miss it.

11

The video began by explaining the concept of artificial life. The program was aimed at a general audience, and its makers had assumed they needed to nail down the basics first.

Amano glanced at Kaoru and laughed. "Shall we skip this part?"

He felt it was safe to assume that any son of Hideyuki Futami would have a precise grasp of what artificial life was. Kaoru nodded, and Amano fast-forwarded.

The screen displayed a succession of geometrical patterns, appearing, changing, flickering, and disappearing.

Artificial life did not mean a biotech lab with people cutting and pasting DNA to create man-made monsters. Nor did it involve cloning technology. It was a computer simulation: man-made life forms appearing and disappearing on computer monitors.

It was fair to say that the idea behind artificial life had come from the Life Game, a computer game in general circulation toward the end of the last century.

In its earliest forms, it was rather like playing on a chess board. The computer screen was filled with intersecting lines in two dimensions, like a chess board, only with a far greater number of squares. Each square was known as a cell. A cell could be either alive or dead: a "living" cell was black, while a "dead" cell had no colour. A glance at the board showed only the "living" cells, coloured black. Each cell bordered eight other cells on the top, bottom, left, right, top right, bottom right, top left, and bottom left. Rules were determined for the cells. For example, it might be decided for a "living" cell that if it bordered on two or three "living" cells, and neither more nor less, it would survive to the next generation; if it bordered on no "living" cells, only one, or four or more, it would "die".

At the beginning of play, living and dead cells were randomly determined, and play proceeded from one generation to the next, time advancing digitally, with cells living or dying in each generation. If a cell had two or three cells adjacent to it, it would be sustained by these neighbours and live on, while if it had one or no cells nearby, it would die of loneliness, and likewise, if it had four or more neighbours, it would die of overcrowding.

Since the living cells were represented by black squares, with each passing generation the monochromatic pattern on the display changed.

The principle behind the game was quite simple, but in actual play a wide variety of patterns was possible, with highly suggestive results. One pattern found squares spreading slantwise after a certain number of generations. Another pattern saw what looked like repeated tremors. Some patterns were stable, with no change at all. Some patterns negotiated with each other, changing shape on the board like living beings. These changes continued until all the cells had died out, or the patterns all became fixed, with no further movement.

As they developed the concept of the Life Game, researchers started to detect what seemed like signs of life within their computers. The first element of the definition of life is that it can reproduce itself. As soon as self-propagating patterns were discovered in the Life Game, researchers from many disciplines began to lend their expertise, in the hopes that keys to the beginning and evolution of life on earth might there be found.

It was this chain of events which led to Hideyuki Futami, with his background in medicine, to work with computers on the artificial life project. No doubt Amano the microbiologist had similar reasons for joining the centre. Science had progressed to a point where it could go no further without breaking down the walls between disciplines and enabling a more dynamic exchange of ideas.

Amano stopped fast-forwarding at an appropriate place and pressed PLAY.

"There. Now it gets into the aims of the Loop research."

Hideyuki's face was onscreen now. Kaoru felt a tightening in his chest as he saw his father's youthful countenance-this had been filmed not long after his marriage. His hair was still thick, his whole being suffused with passion and confidence. The firmness of his muscles was evident even through his clothing.

Come to think of it, this was the first time Kaoru had seen video of his father from before Kaoru's birth. He hadn't been expecting it-it was surprise as much as anything that shook him.

The image changed to a vast desert in America, to a superconducting super accelerator some thirty miles in diameter, part of a project long since abandoned. Aerial shots showed the exterior, and then the scene cut to the interior. The huge ring-shaped research facility, once a useless hulk, was now filled, the video revealed, with a huge number of massively parallel supercomputers. The numbers were incredible. Six hundred and forty thousand computers buried beneath the desert sand: a truly overwhelming sight.

Then the scene made another abrupt shift, this time to the skyscrapers of Tokyo. The camera went underground again, into a maze of abandoned subway tunnels branching out like a spider's web. Here, too, were installed 640,000 massively parallel supercomputers. Underground, where the humidity was low and the temperature was relatively constant year-round, was the ideal place for the computers.

This joint Japanese-American collection of massively parallel supercomputers-a staggering 1.28 million in all-was there to sustain the Loop.

Hideyuki reappeared onscreen. Having shown off the hardware that drove the Loop, it was time to explain the software.

Hideyuki pointed to a computer screen and narrated in precise, well-chosen words while the process of cellular division was demonstrated through symbols. The Hideyuki Kaoru knew was inclined to speak quickly and animatedly, but the Hideyuki on the video averted his eyes from the camera and spoke somewhat shyly, although not without confidence.

Kaoru already understood what Hideyuki was explaining now. Although it had been research in progress then, from a standpoint twenty years on, it was fairly easy to comprehend. But what was their methodology? These were the first detailed images Kaoru had seen of the project, and his interest was captured.

The monitor Hideyuki was pointing at showed the development of the cell of some organism, and next to it the same process recreated artificially and represented symbolically. A natural cell and a man-made one, side by side. Over time, they both took roughly the same shape. The process by which the real organism formed was translated into symbols and manifested in the computer simulation. Upon the incorporation of various algorithms, the shape of an organism appeared on the monitor.

The idea behind the Loop project, a joint Japan — U.S. undertaking, had been to create life within the virtual space of the computers, pass on DNA from generation to generation, and incorporate the mechanisms of mutation, parasitism, and immunity, thereby to create an original biosphere to simulate the evolution of life on earth. In short, to create another world exactly like the real one, on computers.

At this point, Amano paused the videotape and turned to Kaoru.

"Do you have any questions thus far?"

"Well," Kaoru spoke up. "What field, exactly, was this research supposed to be useful to?" This had been nagging at him for some time. Where did the funding come from? What kind of practical application would this research have had?

Judging by what he'd seen, the budget was probably big enough to require government support. Solving the riddles of life on earth, the mechanism of evolution, would be sure to satisfy academic curiosity, but he doubted it'd make money for anybody.

"We were taking the long view. We knew that at first it would be of only limited use. But once we opened up the field, there was no telling what kind of developments would pop up later. The number of possible applications was literally infinite. Fields like medicine and physiology for starters, but also microbiology, physics, meteorology… And not just science: we expected it to have implications for everything from understanding movements in stock prices to figuring out social-science problems such as population increases."

Amano paused and laughed.

In fact, the fruits of the Loop research had proven useful on a wide variety of fronts. It became possible to know the point at which earth's environmental and ecological balance would be destroyed, allowing for the development of management strategies; there were epochal advances in the study of at what point in the brain's development consciousness appeared. The contribution to medicine was huge, as treatments for several serious illnesses came to light.

The rest of the video was spent mostly on methodology. Hideyuki used diagrams to explain how through the application of chaos theory, nonlinearity, L-systems, genetic algorithms, and the like, the program was able to learn and evolve.

As an example, fragmentary images of cellular division were interspersed into the narrative. A shot of a cell dividing and redividing until it grew into an organism pulsated its way across the screen as if on fast-forward. The network developed dynamically, rather like a cancer cell growing capillaries. Even though Kaoru knew it was a mechanical simulation, it looked remarkably alive.

Having concluded its explanation of the methodology and thus its introduction to the project, the video ended with an invitation to the viewer to follow the real-life progress of the experiment.

Kaoru found it a pretty convincing promo.

Creating a computer simulation of the beginning and evolution of life wasn't a particularly unusual thing: it had been done several times in several different places. What amazed Kaoru was the scale of this project: the minute level of detail, the innumerable parameters that had been fed into the program. He figured it had to be the first time anything like it had been attempted.

What the experiment did was to take the some four billion years since life had begun and compress them into an accessible digital time frame. Billions of years had been abbreviated on the computers into ten or so years of real time, while still perfectly recreating in the virtual space the complexity of the real world.

Kaoru was curious about the subsequent progress of the research.

"How far did the Loop go?" he asked Amano, who was rewinding the tape.

"Didn't Futami-sensei tell you?"

"He told me that the pattern turned cancerous, that's all."

Amano looked troubled. "Well, that's about the size of it."

"I'd like to know more about the sequence of events, though."

"I'm sure you realize that even if you had the time to look at it, your life would end long before you finished."

Kaoru sighed intentionally.

"Okay, why don't we move to a different room and talk over coffee? I'd like to hear more about your father's condition, actually."

Amano led Kaoru into a larger but drearier room that looked like it was used for meetings or training sessions. It contained steel desks and folding chairs, and instead of modern art the walls held a map of the world; all in all it was an unremarkable room, sort of like a school classroom in miniature.

They sat at a table facing each other, and from nowhere appeared the receptionist to place cups of coffee in front of each of them.

It looked hot, at least: steam rose from the disposable cups. Amano wrapped both hands around his cup and brought it to his mouth. This room was windowless, too, and the air conditioning was turned up too high. Up to now Kaoru had been so wrapped up in what he was hearing that he'd been oblivious to the cold inside the centre. As he watched Amano take advantage of the warmth of the coffee Kaoru finally noticed that his own arms had goose-bumps from the cold.

In between sips, Amano began to relate the history of the virtual world.

He spoke like an old man telling him storybook stories: relating the simulation in the form of a story was probably the most primal, direct way to go about it. In any case, it didn't strike Kaoru as inappropriate. Simulation it may have been, but it was also life, and it was natural for its history to contain story like elements.

Perhaps that was why Kaoru was able to become comfortably absorbed in Amano's tale. It was fun to re-experience the history of the world. But only until just before the end.

12

"… But even after we implanted RNA, which meant the ability to self-replicate, for a while it remained a normal, chaotic world. It put some of the staff in a bad mood-they were afraid it would change nothing at all.

"But there were a few who had a more upbeat outlook. After all, real life had developed along much the same lines. Primitive life began, single-celled organisms, and then just stayed like that for three billion years with very little change, no signs of evolving.

"One day, just as we'd expected, complex life forms began to appear-just as the Cambrian Explosion came along in real life. We have no logical explanation for why varied life forms appeared at just that moment. Extremely simple life forms, similar to single-celled organisms, begat many-celled organisms, through a mechanism that was identical to how it happened on earth, they say.

"The life that emerged then became the prototype for the natural world that would later develop. Some life retained the same form and became naturally extinct, while some life began to evolve into more complex forms. The family tree branched out, the phenomena of parasitism and symbiosis appeared, life emerged that moved in fascinating ways. Things that moved like worms burrowing their way through the earth. Things that moved swiftly through the seas. Things that soared through the air like birds. And things that stagnated, giving up on evolution and remaining single cells forever. These can probably be likened to bacteria and viruses. There were things whose pictorial representation was large but which didn't move: these took forms like those of trees on earth.

"Of course each living thing had information that corresponded to genes, and every time they reproduced, a certain percentage of errors crept in, mutations that resulted in evolution in a positive direction, stagnation, or extinction. We'd done a good job of incorporating natural selection, the competition to survive.

"Observing this process, we were astonished to see something emerge that could only be gender. In the natural world, too, it's considered a mystery why species branched into male and female. In our world, too, a bifurcation occurred that clearly couldn't be explained except through reference to male and female.

"Some simple life forms were still able to reproduce without coupling with another of their species, but complex life forms now had to mate within their species in order to self-replicate. Just as we'd predicted, once the gender distinction arose, genetic information came to be combined in more dynamic ways as it was passed down to the next generation: this made for diversity, and evolution picked up speed.

"Please don't misunderstand. I didn't actually witness this myself-I heard some older colleagues talking about it. But it's pretty exciting, don't you think? The idea of artificial life forms inside a computer having sex is pretty interesting, is it not?

"With the Cambrian Explosion as a jumping-off point, life changed into complicated patterns with wondrous speed. One minute huge life forms that resembled dinosaurs appeared, and the next minute they were extinct.

"What came next was life forms that incubated the next generation's information inside the parent generation until it had achieved a certain degree of maturity, and only then divided. I'm sure you recognize what I'm talking about: mammals.

"Things went on like this for some time, until the appearance of what seemed to be the ancestors of the human race. I've pulled that scene up and watched it myself. Imagine it, if you can. At first they moved like orangutans. Then, through a long period of trial and error, their walking became smooth, free of the awkwardness it displayed at first.

"At this point the amount of genetic information was extraordinary, and soon thereafter there emerged a life form that we guessed must be humanity. It was obvious that this life form was aware of itself, that it possessed intelligence. Obvious, because these life forms were actually observed making what seemed to be signals to one another.

"By exchanging digital signals, zeros and ones, these life forms were able to manipulate more and more information. As a result, their survival rate went up. It was unmistakable: they'd acquired language.

"By analyzing the clusters of zeros and ones they exchanged, we were able to translate their exchanges of information as language. Of course, the beings within the Loop didn't consider themselves to be interacting in binary code. As far as their awareness went, they were utilizing complex language the same as you and me.

"Once we'd analyzed their language so that we could interpret it using machine translation, it became a much more interesting world, they say. You could call up any scene on the display as a three-dimensional image, and it was just like you were a character in a movie.

"These artificial life forms began making their own history. Similar individuals came together in groups, states fought wars and engaged in political machinations. They advanced their civilization and designed their own world as if it was their own. It's said that watching it was like watching human history itself.

"The price was that as their history advanced the level of information being generated rose, and time began to move more slowly. The computers had a limit to their processing ability.

"The first three billion years from the creation of the earth had only taken a half a year on the computer. But the speed began to slow as life began to emerge, and especially after it evolved into intelligent forms on a level with human beings. At the end it took the computers two or three years to advance the Loop a few centuries.

"The Loop, as a virtual world, was recognizable and knowable to the staff of the research centre. But it was utterly impossible for the sentient beings within the Loop to know us, their creators. To them, I imagine we were God Himself. As long as they were within the Loop, they were unable to comprehend how their world worked. The only thing that would have enabled comprehension was for them to get outside of their world.

"The progress of their civilization was marvellous. Their cities contained entertainment districts with flashing neon signs; they overflowed with sound and colour. All manner of media sprang up, dramatically broadening the reach of information, and people lived lives filled with the pleasures of the musical and verbal arts. Their lives were no different from ours by this point. They had artists just like Mozart or da Vinci, who played the same historical role as in reality, adding vibrancy to their culture. Their world was beautiful, but at the same time it began to have an air of decadence. Some of our staff members were enraptured, while others began to whisper forebodings of doom. There were signs all over the place that something unpredicted was about to happen.

"And the premonitions were right on target. The Loop, the entire living world, began to turn cancerous…"

Amano paused there for a breath, and to bring his coffee cup to his lips. It was empty and he knew it; the gesture was simply something to do with his hands. Had he been a smoker, he would have lit a cigarette at this point.

"What do you mean, turned cancerous?"

Amano shrugged slightly and lifted his hands in a pose of surrender. "The Loop biosphere came to be monopolized by identical genes. It lost diversity and began moving toward extinction."

Kaoru looked at the ceiling, as was his habit. He tried to make sense of what Amano had told him.

They had created a three-dimensional virtual space inside an ultrafast supercomputer system, a world that didn't exist in reality, and they'd named this space the Loop. The space itself was large enough that from the point of view of the life forms within it, it might as well be considered an infinite universe. The experimenters had established conditions of soil, topography, and physics so that the world would be just like the primeval earth. Mathematically speaking, it was a world supported by the same formulas and theories as the real world. Not only the speed of gravitational acceleration and the boiling temperature of water, but the very landscape was identical to that of earth.

Carbon, hydrogen, helium, nitrogen, sodium, oxygen, magnesium, calcium, iron, and the rest of the 111 elements had been deposited, each according to its properties. Rules were laid down so that they would act exactly as they did in the universe enveloping the earth: two hydrogen atoms (H(2)) and one oxygen atom (O) when combined would form a water molecule (H(2)O), and this would react with a nitrogen molecule (N(2)) to form ammonia (NH(3)).

Fundamentally, no reason exists in the world to explain why two hydrogen atoms and one oxygen atom, when combined, have to form water: the rules are simply set up that way. And who made the rules? If you had to give it a name, it would be God.

The fact that evolution in the Loop proceeded exactly as it had in the real world was suspected to be due to the first primitive RNA life form that had been caused to be born. Or, rather, since the physical conditions of the Loop had been precisely modelled on those of the real world, evolution there probably couldn't help but follow the path it had already followed in the real world.

One of the purposes of the Loop was to enable researchers to trace the actual process of evolution. If evolution in the Loop followed the same path as it did in reality, then the results of the Loop's evolution would predict the future of the real world.

Suddenly chills ran along Kaoru's spine. The Loop predicted the future of life on earth. All life would turn cancerous.

What in the world? That's exactly what's happening now.

Cancer cells reproduced with no respect for persons, they were sexless, and they were immortal to boot. At the moment there were only a few million victims worldwide, but there was always the chance that the numbers would shoot up due to some mutation or population explosion in the MHC virus. It would be the same as what had happened in the Loop. Was it just a coincidence? Or was the Loop in fact an accurate prediction of the future?

As he sat before Kaoru, Amano was not about to assert a scientific connection between the results of the Loop and reality. And it was no wonder. How many people would believe such a ridiculous story?

Kaoru struggled to mask his shock with rationality as he asked, "What was the cause? Why did the Loop's life forms turn cancerous?"

Amano answered him in clipped tones. "That's easy. It was the appearance of the ring virus. But that emerged in a way we simply don't understand, as if by magic."

"You're saying that a single virus managed to influence all of the patterns in the Loop?"

"Yes. It shouldn't be that hard to believe. Not when a butterfly flapping its wings on one side of the world can affect the weather on the other."

The butterfly effect. Kaoru guessed it wasn't all that strange that the ring virus could change the fate of the Loop world. What he didn't understand was why it had appeared.

"Are there any theories as to the emergence of the ring virus?"

"Theories?"

"You know, like maybe one of the staff members introduced it into the program."

"Security was perfect."

"Well, maybe it was a computer virus."

"That's not impossible. In fact, they say most people took that view."

Something appeared to be bothering Amano; he seemed to sink into thought.

"Excuse me, but is there anybody from the original staff I can contact?"

Amano smiled wanly. "I'm the only survivor," he said, then hurriedly put a hand over his mouth. Hideyuki Futami wasn't dead yet. Kaoru didn't let it bother him, but laughed bitterly.

Amano quickly added, "My participation in the project was limited to the very final stage, just before it was shut down. You'd be better off consulting the father of the whole project, Cristoph Eliot, but he's hidden himself away…" Amano fixed Kaoru with a meaningful gaze and then continued. "Oh, I do know of one person who was fairly close to the centre of the project. An American researcher. Supposedly an odd duck-he had problems with teamwork."

"Do you know his name?"

"Wait a moment," Amano said, and stepped out of the room. When he returned, several minutes later, it was with a file under his arm. He flipped through it. "Ah, there it is," he muttered, glancing up at Kaoru without raising his head. "Kenneth Rothman."

Kaoru repeated the name. He was an old friend of his father's. He'd visited five years ago: there were photographs of Rothman and members of the family standing on their balcony overlooking Tokyo Bay. Rothman had been in Japan to speak at a conference, and Kaoru's father had put him up for several days.

Those days were deeply etched in Kaoru's memory. Rothman's appearance left quite an impression, from his thin goateed face to the gold chains that flashed around his neck and wrists; his manner, too, was impressive, from the cynical smile he'd flash during scientific discussions to the cutting logic with which he'd announce his pessimistic analyses of the future.

"Has Futami-sensei told you anything about this man?"

"Yes, he's a friend of my father's. I've met him myself once, five years ago. I remember his beard, mostly. Where is he now?"

Amano flipped through the file again.

"According to this, he moved from Cambridge to the laboratories in Los Alamos, New Mexico, ten years ago."

New Mexico. The name sent a jolt through Kaoru's brain. He looked around the room, then stood up and took a close look at the world map on the wall.

Los Alamos, New Mexico. He held down the spot with his finger: it wasn't far at all from the Four Corners of New Mexico, Arizona, Utah, and Colorado, where his family had been planning to go.

Kenneth Rothman had moved there ten years ago. The first MHC victim had been in New Mexico. The coincidences were piling up…

Kaoru shut his eyes tightly. He couldn't help but feel that an important clue lay hidden there. Hoping against hope, he asked, "Is it possible to contact him?"

Amano's answer was brusque.

"I sincerely doubt it."

"Why is that?"

"The last I heard from him was six months ago. What I heard then grabbed me, but I haven't been able to contact him since."

"Grabbed you how?"

"Something about having figured out the MHC virus, and that Takayama held the key… Tantalizing, isn't it?"

"Takayama? That's someone's name, I take it? Whose?"

"I'll give you the short version. The canceriza-tion of the Loop came about through the emergence of an unknown virus and a series of events linked to it. At the center of those events were three artificial life forms: one called Takayama, one called Asakawa, and one called Yamamura. It's been determined that these three life forms played important roles in the cancerization of the Loop."

"The artificial life forms have names?"

"Of course."

"So Kenneth Rothman disappeared, leaving behind nothing but the name Takayama?"

"Yes. I didn't think much of it-in this day and age, when I lost contact I simply figured that the cancer must have gotten him, too." Amano threw up his hands. "Especially in his case. He had his own laboratory in a remote town called Wayne's Rock. It was the kind of situation where he could slip out of touch at any time and nobody would be too surprised."

"Wayne's Rock?"

"Wayne's Rock, New Mexico. Basically a ghost town in the middle of the desert."

Kaoru sighed and turned back to the map, placing his fingertip on one particular spot.

Wayne's Rock, New Mexico.

He had the feeling Rothman was waiting for him there, in his lab.

His finger still on the map, Kaoru turned back to Amano. "Have you watched the whole series of events involving Takayama and Asakawa?"

Amano shook his head. "No. I think only a few staff members watched it. The memory is stored in America, not here."

This aroused Kaoru's interest still more.

"Would it be possible for me to… see it?"

"It would take a while, but it wouldn't be impossible. I think you'd be wasting your time, though," was Amano's answer. Kaoru's finger was still on the map.

13

It had been some time since he'd gone out onto the balcony at home and gazed at the night sky. Even from a hundred yards above he could tell that no ripples disturbed the black surface of the bay. It was a hot, windless evening. The humidity bathed him where he stood.

He saw the sky differently this evening-he couldn't help but do so after everything Amano had told him this afternoon about the contents of the Loop. As a child, so full of the desire to understand the universe, he'd stared at the glittering stars with a passion born of the feeling that if he just looked long enough he'd understand.

What's at the end of the universe? That was the kind of naive question that had presented itself to him. Staring at the cosmos now, it was utterly beyond his imagination what might lie outside the universe.

Kaoru tried to imagine himself as a denizen of the Loop. Assuming he were a being aware of time and space, how would he interpret that universe? It would most likely appear to be expanding. The Loop had gradually grown with the changing passage of time. Before the program had been started, there had been nothing there at all. A mountain of silicon chips, yes, but no time, no space. But from the moment the staff had started the program, space had grown at an explosive rate. The Big Bang.

The Loop space did not exist within the massively parallel supercomputers enshrined beneath the ground, just as a nature scene on a movie screen was not actually contained within that screen. That space existed neither inside nor outside the computers. It was only experienced as space by beings able to recognize it as such. As life forms evolved and their awareness grew, that space must have expanded, as if fleeing before the eyes that sought to recognize it.

Kaoru turned his eyes to the actual sky. The universe he was looking at was expanding, but he wondered suddenly if it wasn't simply trying to get far away from earthly DNA and its powers of recognition. He couldn't discard the possibility that the real universe was a hypothetical space just like the Loop. Would that interpretation cause any inconvenient problems?

No, it wouldn't. In fact, he felt that regarding the real world as a hypothetical space was getting closer to the truth. Maybe the ancient ways of thinking-the Buddhist idea that form is emptiness, or the Platonic notion of the ideal world-did a better job of capturing the reality of things.

And if one assumed the universe was a virtual space, then there was the possibility that it was being observed through an open window in space, just as humans had been able to peek into the Loop world. Make the right time and space adjustments, and images of a particular moment in a particular place would unfold on the monitor in 3D.

Kaoru placed one hand on his other arm, then moved it to his chest, his belly, and below.

Do I just think I have a body, when really there's nothing at all?

But there was that little organ located just below the centre of his body, and there were desires which emanated from it. He couldn't believe those were without reality. As he touched it, stroked it, he thought of Reiko's face.

There was nobody behind the glass door at his back. The television was showing something different from a while ago. His mother was probably shut in her room, absorbed in Native American myths.

Kaoru glanced behind him, and then allowed his organ to tower in the direction of the window that might be there in space somewhere; allowed it to insist on its existence.

Kaoru wanted to shout to the night sky: This flesh can't be a fictional construct. Reiko’s body can't be a fictional construct.

14

There in the awkward darkness, Kaoru considered the two facts of which he'd just been made aware. Both were pieces of extremely bad news, and it was taking him a while to accept them. He knew they were coming, but now that they'd come he couldn't help but go unnaturally rigid as he looked down at his father.

Up until a few minutes ago Kaoru had been in Ryoji's sickroom. As soon as Ryoji had been taken away for his test, Kaoru had locked the door from the inside and lost himself in passion with Reiko. Afterwards, he'd stopped by his father's room. What he'd heard there felt like a punishment for lewd acts in an inappropriate place. The scent of Reiko's skin still lingered in his nostrils, and he could still feel the soft touch of her skin here and there on his body. On a deep cellular level his excitement had yet to subside.

Now he regretted coming to his father's room while still in the throes of afterglow.

His father seemed to have physically shrunk a size over the last few days-the swelling of the sheet over his chest was pitifully small. When Kaoru was a child his father had been a giant in his eyes. He could beat on his father's muscular chest with both fists and his father wouldn't flinch in the slightest. His physique had been out of place on a scientist, but now it hardly disturbed the flatness of the sheet.

So it wasn't that much of a surprise to hear that the cancer's spread to his lungs had been confirmed. But still it was news he hadn't wanted to hear-he'd been putting off thinking about it for so long-and revulsion was his first reaction, followed by something like anger as the facts sank into his head.

"Don't just stand there. Have a seat." Whereas Kaoru's expression as he stood there was one of rage, Hideyuki's was soft. Kaoru only then realized that he'd been standing ever since hearing the two pieces of bad news.

Kaoru did as his father said and sat down on a stool. Suddenly his anger receded; he felt drained.

"Are you going to have surgery?" His voice sounded hollow to himself.

Hideyuki had the answer ready. "No, not this time."

Kaoru was of the same opinion. Cutting the cancer out of his lungs wasn't going to prolong his life. The end result was all too clear. Chances were, an operation would actually shorten his life.

"Right," was Kaoru's response to his father's determination.

"But never mind about me. This has turned into something really nasty." Hideyuki was referring to the information Saiki had just brought him.

The second piece of news had to do with the results of animal experiments conducted simultaneously but independently in Japan and America. Until this point, it had been thought that the Metastatic Human Cancer Virus only affected humans: only humans could catch it, and only human cells would turn cancerous under its influence. But experiments on mice and guinea pigs had just revealed that animals could contract the disease, as well.

It wasn't yet clear whether this was the result of a mutation in the virus, or whether its ability to infect non-humans was simply something that had been overlooked up until now. What was important was the threat of animals in close contact with humans, dogs or cats or even smaller animals, becoming carriers of the virus. If this happened, it was to be expected that the virus would spread even more explosively than it already had. Events in the real world were taking on an even crueller resemblance to the end stages of the Loop. There, the cancerization had affected all life-form patterns. If the analogy held up, the MHC virus wouldn't cease its attack until all life on earth became cancerous.

Even if Kaoru hadn't gotten the virus from Reiko, it would invade his body somehow, by some route or another. It was inevitable. At least, that was how he tried to rationalize his relations with her, even as he closed himself off to imagining the doom that awaited him.

His father's voice reached him as if over a great distance.

"Huh?"

"Hey, are you listening to me?"

"Sorry."

"You spoke to Amano, right? Tell me your impressions."

It was a vague enough question.

"Well, a few things bother me about what he said."

Hideyuki nodded. "I'll bet."

"Dad, was it really only recently that people started to notice that reality was starting to look like the way the Loop wound up?"

"The Loop project started thirty-seven years ago and lasted for seventeen years. The program was shut down five years after I joined. That was twenty years ago. That world had disappeared from my memory. It's really only in the last few days that I've started worrying about the way the Loop ended."

Kaoru found this statement of his father's totally unbelievable.

Ten years ago, when Hideyuki had steered the conversation away from the Loop, refusing to tell Kaoru how the project had turned out, it had to have been because he was bothered by the way it had ended. All life forms within the virtual space losing diversity, turning cancerous, and going extinct-it wasn't the kind of story to tell a ten-year-old kid. No doubt Hideyuki hadn't wanted his son to project that story onto the real world and thereby fall into an unhealthy obsession with the end of all things.

Because he'd felt that a child's view of the future of mankind should be sunny, Hideyuki had distanced his son from the Loop. Which meant that in at least a corner of his mind Hideyuki had been worried all along about the conclusion of the Loop experiment.

"Dad, about the reason that the Loop turned cancerous…"

"It was the appearance of the ring virus."

"Could somebody have introduced it into the program?"

Hideyuki was silent for a while, as if pondering the idea.

"Why do you say that?"

"Because nobody could explain how the virus came to be. It couldn't have emerged naturally. So if it couldn't have been born on the inside, isn't it most natural to think it was brought in from the outside?"

"Hmmph."

"Isn't it?"

"If people could just start introducing things once the program had already started to evolve, it would have nullified the whole experiment. Security was flawless."

At this point, Kaoru mentioned a name. "You know Kenneth Rothman, right?"

Still face up on the bed, Hideyuki turned his eyes toward Kaoru.

"Did something happen to him?" he finally managed to choke out. He was bracing himself to receive another death notice.

"Do you know where he is?"

"I heard he was in New Mexico, still researching artificial life, but…"

"Yeah, supposedly he moved to the laboratories in Los Alamos. But nobody knows where he is now. And just before he went missing he mentioned something that sounded pretty important. He said he'd figured out the MHC virus, and that Takayama held the key."

"Takayama…"

"Dad, did you watch the scenes in the Loop involving Takayama?"

Kaoru's question sent Hideyuki deep into his thoughts again. His eyes darted around desperately as, with his weakened vitality, he tried to recall something.

He was clearly shaken. It was only natural that his memory should become somewhat opaque after several major surgeries and his long battle with cancer. But still it was setting Hideyuki's nerves on edge that he could find no answer to his probings into the darkness of his memories.

"I… I don't think so."

Kaoru decided to ease his father's struggles by changing the subject. "Oh, Dad, another thing. The MHC virus has been sequenced, right?"

"Saiki brought by a printout of it two days ago."

"Well, have a look at these figures."

Kaoru showed the printout to his father; he'd highlighted with a marker the total number of bases in each gene.

"What about them?"

"Look at the number of bases."

3072-393,216-12,288–786,432-24,576- 49,152–196,608-6144-98,304.

Hideyuki read the nine numbers off in order. But by the look he turned on Kaoru it was evident he hadn't noticed anything special about them.

Kaoru enunciated clearly as he explained. "Get this, Dad. All nine of these numbers equal two to the nth power times three."

Hearing this, Hideyuki looked over the numbers again at some length, before crying out. "Nice catch!"

The old light returned to Hideyuki's eyes as he lost himself in their scientific back-and-forth; it only lasted an instant, but that was long enough for Kaoru to notice. It pleased him at the same time that it made his chest tighten. How long had it been since his father had praised him like this?

"Do you think it's a coincidence, Dad?"

"It can't be. What are the chances of all nine numbers-some of them six digits turning out to equal two to the nth power times three? Extremely low. Any time something overcomes that kind of improbability, it means something. You were the one who told me that, that night ten years ago."

Hideyuki gave a weak laugh. Kaoru replayed in his mind his memories of that night and his family's back-and-forth; a summer as hot as this one and a childhood dream fanning anticipation of a trip to the North American desert. That place, once a fun-filled destination for a family vacation, had changed drastically for him, but it still drew him with great force.

As Kaoru and Hideyuki sat there reminiscing about times spent together, the hospital corridor outside burst into a commotion.

Two or three people ran past, creating a sense of tension not often felt in a non-emergency ward. Apprehensions stirring, Kaoru listened closely.

He heard what sounded like a woman's scream mingled with a male voice barking commands. The woman's voice sounded familiar. He was sure of it: it was Reiko.

"Excuse me," Kaoru said, glancing at his father and getting up.

He opened the door and looked up and down the hall. He saw a woman scurrying down the corridor away from him, following two men in guards' uniforms. She was wearing a casual yellow housedress; the zipper on her back wasn't zipped all the way up. Kaoru himself had fumblingly unzipped that dress not long ago; he knew the white neck above it. This was Reiko.

She wore sandals with no socks; a further glance showed that she was in fact only wearing one sandal. This made one shoulder rise and fall with her strides. She must have been in quite some hurry as she'd left her son's sickroom.

Realizing the situation must be urgent, Kaoru chased her, calling her name.

She didn't even look back, but followed the two guards around a corner and through the door to the stairs, beside the elevator.

She was screaming; just what her screams meant was not clear. It sounded like she was calling out a name, but with all the noise, Kaoru couldn't make it out.

"Reiko!"

Kaoru sped after her, opening the stairwell door as it slammed shut in front of him and rushing in. In the stairwell was a freight elevator, and beyond that the fireproof door to the emergency stairs. This door opened from either side, in case of emergency, but any unauthorized entry by this means would show up on the security monitors, bringing guards at a run. Of course, the system was also designed to prevent people from jumping to their deaths.

Reiko and the guards opened the door to the emergency stairs, and over their shoulders Kaoru could see the child. The outside wall had a window in it, marked with a red triangle: this window opened from the outside or the inside, so that firemen could use it as an entrance in an emergency. The window was open now, and curled up on the windowsill sat Ryoji.

The boy turned a mocking gaze on the panicking adults and continued to kick and dangle his legs in his usual way.

As soon as they saw Ryoji, the guards stopped in their tracks and began trying to talk him down.

"Calm down."

"Don't do it."

"Come down from there."

"Ryo!" Reiko croaked, not at her son but at the narrow square of ceiling above him.

Ryoji seemed to notice Kaoru standing behind his mother. Their eyes met. Then Ryoji rolled his eyes back in his head until only the whites were visible, and leaned back. Kaoru's last glimpse of Ryoji's eyes showed him something no longer alive.

The next instant, Ryoji threw himself toward the sunset behind him and disappeared.

15

Kaoru sat next to the bathtub with his hand in the running water, adjusting the temperature so that it would be on the tepid side. At first the water felt a bit hot to the touch, but as he grew accustomed to it he decided it was close to body temperature. Then he got in and sank back until the water was up to his shoulders. He soaked a while. Once the last droplet had fallen from the tap, the bathroom was silent. It was unusual for him to take a bath on a weekday afternoon like this.

He lay back until his head rested on the rim of the tub, closed his eyes, and pricked up his ears. He hugged his knees and curled into the foetal position. He had the feeling that his heartbeat was being picked up by the water, making wavelets in the tub.

He tried to empty his heart, but it was no use. The same scene kept replaying in his mind.

It was nearly a week since Ryoji had jumped to his death from the hospital emergency stairs.

Help me. Help Ryoji.

Ryoji had ended his young life before Kaoru's very eyes, forsaking his mother's wishes.

The sight of Ryoji jumping had made a strong impact on Kaoru. The moments just before and after, the empty look in Ryoji's eyes as he leaned backward, Reiko's scream. The images, the sounds, the most fragmentary details were tragically etched into Kaoru's brain. They'd appeared in his dreams every night for the last week.

Immediately after Ryoji had jumped, Kaoru and Reiko and the others had rushed to the window to look out. They could see the boy's body twisted unnaturally from its collision with the concrete. They could see rivulets of blood, all flowing in the same direction, shining reddish-black in the setting sun. Reiko fainted on the spot; Kaoru picked her up. He made arrangements for Ryoji's body to be taken into the emergency ward, but he already knew just by looking that it was too late. The chances of surviving a twelve-story drop onto a concrete surface were virtually nil.

Sometimes he dreamed about the stain Ryoji's blood left on the concrete. The stain was still there, in a corner of the hospital courtyard. The boy's life was gone, but it had turned into a shadow which lingered on the surface of the walkway. Kaoru couldn't make himself go near it.

Ryoji's suicide was an impulsive act, but there was something premeditated about it, too. When he made his move he'd dashed straight for the window in the emergency stairwell. He must have known the windows there were the only ones that opened from the inside. He must have had his eye on them for some time.

The motive for his suicide was obvious. He'd finished the scintigram, and was now facing his fourth round of chemotherapy. He must have been filled with revulsion at the thought of that miserable struggle starting again. And it was a struggle against an enemy he couldn't defeat. Sooner or later, his life would end, and until then there would be only agony. He must have begun to weigh the question of which was better, to prolong his life a little and thereby ensure more suffering for himself, or to cut his life short and spare himself the pain. Perhaps he'd taken into consideration the way his mother suffered watching him.

With the MHC virus ravaging his body, Ryoji had chosen death. Kaoru could understand his feelings, could understand them painfully well. This was something that touched him-a catastrophe that would befall him in the not-too-distant future. This was an enemy Kaoru himself would have to fight. He understood Ryoji's act.

But that didn't mean he wanted to end up the same way.

You 've got to concentrate all your intelligence on confronting this enemy that wants to destroy your body, your youth.

Those were his father's words. If he wanted to escape death, he'd have to fight, and he'd have to win. And he had only one weapon, just like his father had told him: his intelligence.

Kaoru sank deeper into the bathtub. Now the water was up to his earlobes. Do I have that kind of strength?

The more he thought about it the stranger it seemed. All these events connected with the MHC virus springing from somewhere close to him, closing in on his body as if he'd been assigned to save the world.

You 're overestimating yourself.

Unable to stand the heat any longer, he got out of the tub.

Saving the world actually had a nice ring to it. He wouldn't mind looking like a hero, playing at saviour. But he had a personal matter he had to attend to first. Nothing world-class-something far more local in scale. This evening, for the first time in a week, he had a rendezvous planned with Reiko.

He wiped himself clean of perspiration and then put on a brand-new T-shirt and jeans.

He hadn't seen Reiko since Ryoji's funeral.

Since then, she'd refused even to meet him. Finally, she'd offered to speak with him for an hour this evening. This would be his only chance. Kaoru would have only tonight to find out why Reiko had closed her heart to him.

16

Reiko's condo was on the edge of a wooded hilltop. The building was an ostentatious one, three stories, red brick exterior.

Kaoru went around to the entrance, pressed the buttons for her room number, and waited for a response. The speaker came to life and he heard Reiko's voice softly say, "Come in." A moment later, the door slid open.

He'd already assumed that Reiko was financially comfortable due to the fact that she'd been able to put Ryoji in a private room at the hospital. As he walked down the carpeted hallway to the elevator, he saw his assumption borne out.

Of course, he'd never tried to find out where the money came from. He never asked, and she never volunteered the information. However, she'd hinted that her husband had been socially successful. He'd been older than her; he'd died of cancer a few years ago.

Hers was a corner apartment on the third floor. Before he could even ring the bell, the door opened. She must have been watching through the peephole, estimating his time of arrival.

It had been a week since he'd seen her. She opened the door a crack and stuck her head out. They were face to face. Her hair was combed back and held in place with an elastic band. He noticed a few strands of white.

"Come in." Her voice seemed to recede within itself.

"Long time no see."

She showed him into her living room, where he sat on a couch. For a while neither spoke. Kaoru felt uncomfortable. He didn't know why she was acting so cold toward him, and not knowing that, he didn't know what he should say or how to start.

Reiko wordlessly placed a glass of iced barley tea before him, and then sat down facing him.

"I've been wanting to see you." He reached out for her, but she avoided his touch. She sank back into the sofa, maximizing the distance between them.

The same thing had happened at the funeral. Flattering himself that he was the only one who could heal the pain of losing her only son, Kaoru had tried to put his arm around Reiko's black-clad shoulders, but she'd rejected the gesture, twisting away from him. Inexperienced with women he may have been, but even Kaoru could get the message if it was repeated enough times. But he couldn't fathom the reason behind her persistent refusals. One day they'd been in intimate physical contact, and the next she recoiled from his touch.

Reiko hugged herself tightly, rubbing her arms with her hands as if chilly. But the air conditioning was at a reasonable level, and the room was far from cold. In fact, it was still too hot for Kaoru.

He observed her exterior, hoping to understand the pain in her heart, hoping that if she'd closed herself off to him out of anguish at losing her son, he might yet find a way to comfort her.

He wanted to say something that would give her courage, ease her heart, but the only words that came to him sounded so weak and forced, even to himself, that he was embarrassed to speak them. "Cheer up"-he couldn't bring himself to say that if his life depended on it. And so there was no way to start a conversation.

"How long do you intend to sit there without saying anything?" She said this coolly, looking at the floor. This bothered Kaoru-she'd made it so he couldn't say anything, and now she was reproaching him for his silence.

"Knock it off already," he finally managed to say.

"You…"

She held her head in her hands and shuddered violently. She was crying: every now and then he could hear a sob.

"I want to relieve your sadness somehow, but I don't know how to do that."

Reiko groaned and looked up at him, biting her lower lip. Her eyes were red from weeping, and her cheeks were wet with tears.

"I wish I'd never met you."

Kaoru was shocked.

"So you hate me now?"

That just can't be, he wanted to shout. If she really hated him she wouldn't have consented to meet him. She could have spared herself this awkward scene simply by continuing to ignore his phone calls. And yet she hadn't: she'd set up this tete-a-tete, albeit on the condition that it last only an hour. There had to be something she wanted to talk to him about, some legitimate reason for meeting him.

"He knew." Her voice was suddenly, unexpectedly calm.

"What?"

"About you and me."

"That we're in love?"

"In love? So that's what being in love looks like?" A self-mocking smile appeared on her face.

Kaoru sat bolt upright, startled. What being in love looks like?

"What did he know?"

"What you and I were doing in that room."

She couldn't go on. Kaoru swallowed and said, "He couldn't have known."

"He was a sharp boy. He picked up on it. We were so stupid. How could we… how could we do something like that?" Her heart was starting to crumble.

"But…"

"He wrote it in his note."

"Huh?"

"What do you think he wrote?"

Kaoru swallowed again, bracing himself.

Reiko imitated her son's voice. '"I'll be gone, so you two knock yourselves out.'"

Oh, no.

Kaoru thought of Ryoji in his swim cap, smiling, standing by the side of the pool in his baggy trunks, repeating the words over and over. I'll be gone, so you two knock yourselves out. I'll be gone, so you two knock yourselves out. I'll be gone, so you two knock yourselves out.

They'd taken every precaution. They'd only been together when Ryoji was gone for two-hour tests. Even then, the act itself had been over in less than ten minutes. After it had been accomplished, they'd spent the rest of the time on the edge of tears, eyeing each other with lethargy or regret. Kaoru would sometimes kiss away Reiko's tears and whisper, "I love you."

Reiko rocked back and forth as if having a seizure, as if reading Ryoji's suicide note had stolen her reason.

Kaoru let her weep for a while. There was nothing else he could do. She'd calm down eventually, once she'd cried herself out.

He tried to imagine things from Ryoji's perspective. His mother had seized on the occasions of his tests, moments when he'd been in the worst pain, to abandon herself to pleasure. To Ryoji it must have amounted to betrayal. His mother was supposed to be fighting this illness side by side with him, but instead, she'd sent him off to fight it alone while she got her kicks. No wonder he felt disillusioned. No wonder he'd lost the will to fight. Kaoru had assumed that Ryoji's suicide had been a form of surrender to the illness, but the reality turned out to be something else again.

Up to now, Kaoru had grieved relatively little over Ryoji's death, knowing that the poor kid was destined to die soon anyway. His time would come soon enough, so if he wanted to shorten its remaining length himself, maybe it was better that way. Kaoru had almost felt relief.

But if Ryoji's mother's actions had triggered his suicide… Ryoji's thinking suddenly seemed a little more complicated than Kaoru had imagined.

No doubt Reiko felt the same. She'd paid extra for a private room, she'd hired a tutor on the assumption that her son would return to school someday, and she'd generally tried to show an enthusiasm for life. When you know somebody's going to die, love is letting that person see that you're willing to fight right by his side. She'd wanted to show Ryoji that she would stick by him until the very last moment, but instead she'd simply sped him on his way.

No wonder Ryoji had despaired. And now Reiko was wracked with remorse for having driven her son to that despair, to his death. She'd turned the brunt of her rage on Kaoru, her partner in crime. Kaoru finally understood why she'd fled when he'd tried to put his arm around her at the funeral. Standing in front of Ryoji's memorial tablet, she didn't want to be seen touching him even for an instant.

What Kaoru needed was time to think. He was still young-he didn't know how to deal with something like this. It would've been easier if he'd wanted to end their relationship. But he had no intention of doing that. He desperately wanted to find some way to fix things, to overcome this seemingly hopeless situation.

"Can you give me some time?" He decided to be honest with his feelings. He wanted to wait a while, then consider rationally what they should do.

"No." She shook her head violently.

"But I don't know what to do."

"Neither do I. That's why…"

Therein lay his salvation. She hadn't called him here today to put an end to their relationship once and for all. She was admitting that she herself was lost, that she didn't know what to do. She couldn't make this decision alone.

He'd promised only to stay for an hour, but outside the window the autumn sunset was already upon them. It had been the rainy season, early summer, when he'd come to know Reiko. They'd only been together for three months. It felt longer to Kaoru.

The majority of their time together that evening was spent in silence. Sometimes the gaps when they couldn't think of what to say lasted ten minutes or more. But still, Reiko never told him to go home. Kaoru thought he sensed something unnatural in her attitude. Several times she'd be on the verge of saying something, only to bite the words back.

"Reiko, you're hiding something from me, aren't you?"

This made up her mind for her, and she looked up at him. Her expression challenged him.

"I think I'm pregnant."

It took him a few seconds to process what she was saying.

"You're pregnant?"

"Yes."

Their eyes met, and he knew she was telling the truth.

The shock ran up and down his backbone. He simply couldn't grasp this. Death and birth had been almost literally bumping elbows in that little hospital room. The world's cruel irony rankled him. He felt the presence of an ill will invisible to the eye.

"I see."

He heaved a deep sigh.

"What do you think I should do?" Reiko asked.

"I want you to have it."

Saying this, Kaoru leaned forward. He hadn't just been playing when he started this relationship. If there was a child on the way, then he was prepared to raise it-he wanted them to live together.

"What are you saying?!"

Reiko took a newspaper from the magazine rack by the couch and threw it at him. It was this morning's edition.

He knew what she was trying to tell him without even looking at it. He'd read the article this morning.

The article accompanied a photograph of a stand of desert trees in Arizona, in America. The trees had been discovered by chance along US Highway 180 between Flagstaff and the Grand Canyon. According to the article, most of the plants, short trees and shrubs growing low to the brown earth were covered from their trunks to the tips of their leaves with strangely shaped swellings. Of course there are relatively common plant viruses that cause unnatural growth or withering, but these specimens suggested a viral infection on a scale never before seen. The very shapes of the trunks, branches, and leaves had been altered. All signs pointed to the work of a virus. In fact, some were theorizing that the culprit was a mutated version of the MHC virus. Not content to ravage the globe's human population, it seemed that the virus had extended its reach to encompass not only animals but even plants. The sight of these grotesque trees seemed to signal the end of the world. A gloomy article, ending on a doomsday note.

Reiko was a carrier; she just hadn't gotten sick yet. The probability was high that the child within her would be born infected with the cancer virus, too. And if that child were to be born into a world in which the cancer threatened every living thing…

It was all too easy for Kaoru to say that he wanted her to have the baby. She lashed out at him.

"You tell me, where in this world is there any room for hope?"

In the Loop, the ring virus had come in the end to have sway over every life-form pattern, hounding them all to extinction. Kaoru was beginning to know how that felt.

It's starting. Reality is coming to take after the Loop.

"Just give me some time, okay?"

He was forced to beg. He couldn't come to any conclusions right now.

"Will a way open for us if we put off deciding? I'm sick and tired of this. Disgusted. I don't want to have an abortion. Can't you see that? It's like this child has come to take the place of the one I lost. Of course I want to have it, to raise and protect it. But I just can't, not when I think that this child might meet the same fate. To be born into the world only to suffer, to die so young… Help me, please. I don't know what to do anymore!"

He wanted to sit next to her, to let her whisper her pleas into his ear; he wanted to hold her and deliver her from her confusion. But he was afraid it was too soon for that. He fought down the urge.

"So you're not considering an abortion?" He pressed the point, and she slowly shook her head.

"I don't have the strength for that, even."

So she didn't mean to abort the child; still, that didn't necessarily mean she was determined to have it.

Kaoru searched as much of her soul as he could perceive from her eyes, and he thought he caught a glimpse of a decision. She wouldn't abort it, but neither would she give birth to it. Which must mean… was she on the verge of choosing suicide?

Kaoru had one wish now. He wanted Reiko to go on living. In order to ensure that, he had to somehow prove to her that the world was worth living in, both for her and her unborn child. And not just for them, either: he had to learn the value of life for himself. How could he convince anybody else that life was worth living if he himself was willing to abandon the world to cancerization, to loss of genetic diversity, to doom?

I've got to prove it to her so that she can't possibly deny it.

There was only one way: he had to change the course of the world.

How much time would it take? Two, three months? If he hadn't settled things by the time Reiko's belly started to swell, there was every chance she'd choose death. Three months was about all the time he had, then: her nerves wouldn't let her hold out any longer.

"Give me three months. Please. I'm asking you to trust me."

"Three months?!" She gave a feeble scream. "I can't. Something's going to happen to my body, I know it."

"Two months, then."

She stared at him resentfully.

"I can't promise anything," she said at last.

"You have to promise me. For the next two months you can't kill yourself, no matter what happens."

Kaoru placed both hands on the table and leaned toward her. Overwhelmed by his sudden intensity, she recoiled at first, but then a look of relief, of eerie lucidity, came over her. Her indecision seemed about to give way, in one direction or the other. If she could just settle on a direction for now, her suffering would be lessened, at least a bit.

He felt it best to distance himself from her for now, if only to redeem himself from the dishonour of being physically denied. Two months would be about right.

"Two months," she murmured.

"That's right. Let's meet again two months from now. Until then, you have to keep living, no matter what."

"Just stay alive?"

"As long as your heart keeps beating and your lungs keep breathing, and you think of me once in a while, that's enough for me."

She showed him a faint smile.

"I don't know about that last part."

It was the first flash of brightness she'd shown that day. It reassured him.

He needed her to trust him unquestioningly. If she started to inquire-if she asked him, for example, whether or not he was confident in what he was about to do, he wouldn't have satisfactory answers to give her. He felt he had several clues in hand. The unexplained fact that the number of bases in each gene of the virus came out to equal 2" x 3. The fact-only a hunch, actually-that the virus had emerged someplace in the vicinity of Kaoru himself. If he could discover the secrets of its creation, maybe that would lead him to the means of its destruction. He had two months. He'd have to face this situation burdened with the knowledge that Reiko's fate, and his, depended on it.

17

In the elevator, on the way up to the twenty-ninth floor, Kaoru's ears began to ring. The elevator was designed to be unaffected by the change in air pressure, but today he felt a pressure on his inner ear that he'd never felt before. Simultaneously, an afterimage flickered before him.

The sound of Ryoji's bones cracking as his body hit the concrete still lingered in Kaoru's ears. He hadn't actually seen the boy falling; his impression was that he'd heard the body's impact as he himself was running to the window. It was nothing more than that, just an impression, but still the memory of the sound refused to fade away. Now, as the elevator climbed, something had triggered that memory, reviving images Kaoru had never actually seen.

In a somewhat depressed mood, Kaoru opened the door to the apartment and called out, "I'm home."

No reply. Thinking nothing of it, he took off his shoes and placed them in the cabinet by the door. When he looked up again, his mother Machiko had appeared as though out of nowhere.

"Would you come here a minute?"

She grabbed his arm and dragged him to her room before he could respond. Her eyes flashed with the excitement of discovery.

"What is it, Mom?"

Flustered, he offered no resistance, but let himself be dragged along by her intensity.

It had been some time since he'd set foot in his mother's room. Once the room was neat, but now it was piled high with disorderly stacks of books and magazines and photocopies. His mother's expression had changed, too. In fact, she looked like a changed person. Although they lived together, Kaoru felt it had been a long time since he'd really looked at her face.

"Would you tell me what's going on?" Kaoru's nerves were frayed, it being so soon after Ryoji's suicide. He worried about his mother's psychological state.

She seemed blissfully unaware of Kaoru's concern.

"I want you to take a look at this."

She handed him a magazine. The Fantastic World, the title read in English.

"What about it?" he asked in disgust. The title told him all he needed to know about it.

Machiko grabbed the magazine from his hands and flipped through it. Opening it to page forty-seven, she handed it back to him with uncharacteristic roughness.

"Read this article."

Kaoru did as he was told. The article was titled "Back from the Brink: A Full Recovery from Final Stage Cancer".

Another one of these. He understood now. Lately his mother had been pouring all her energy and devotion into looking for a revolutionary way to treat cancer. But she was looking for it outside the bounds of modern medicine, in the "fantastic world" of myths and folk-tales. It was easy enough for him to dismiss it all as just so much alchemical nonsense. But she was his mother, and he had to humour her even if it was uncomfortable. He started reading the article.

Franz Boer, a retired surveyor living in Portland, Oregon, had been infected with the MHC virus several years ago. The cancer had spread throughout his body, and doctors had given him three months to live.

But he'd rejected the doctors' recommended course of treatment, instead embarking on a journey. As part of his trip he spent two weeks in a certain unnamed place. When he finally returned to Portland after a month, the doctor who examined him shook his head in disbelief. His inoperable cancer had completely disappeared.

Cells were collected from the 57-year-old man and tested to see how many times they had undergone cellular division. The result was a far greater number of times than was normal for a man his age.

In other words, Franz Boer had gained two things in that unidentified place: a reprieve from his sentence of death, and, not the same thing, longevity. But Boer, who lived alone, died in an accident before he could tell anybody where he'd obtained his miracle. Now everybody was frantically trying to figure out where he'd gone and what he'd done.

There was little to go on. One persistent reporter had learned that, soon after he'd been told he was dying, Boer had rented a car in Los Angeles. But there was nothing to indicate where he'd be going.

That was the gist of the article.

Machiko watched eagerly for Kaoru's reaction. Stories of miracle recoveries were everywhere these days. But he knew she was expecting something from him. He raised his head slowly with a quizzical expression.

"What do you think?" she asked.

Boer had probably taken a plane from Portland to L.A. Renting a car there, it was possible he'd been heading for the Arizona-New Mexico desert. It fit.

"I know what you're trying to say: Franz Boer was making for the longevity zone I've been talking about for so long."

His mother didn't bother to nod. She just leaned closer with her burning gaze. That gaze told him that she was sure of it.

"There's one more piece of evidence."

"And what would that be?"

"Look at this."

She brought out from behind her back a foreign book and handed it to Kaoru.

The title read North American Indian Folklore. Beneath the title was an illustration of the sun with a man standing beneath it on a hilltop catching the sun's rays full in the face. The man wore a feathered headdress, and his figure was blackened, silhouetted by the sun, as he stood in an attitude of prayer. The book looked to be old: its cover was faded and the edges of its pages dirty from handling.

As soon as Machiko handed him the book, Kaoru turned to the table of contents. It ran to three pages, seventy-four items. Each heading contained at least one word he was unfamiliar with. Hiaqua, for example-he'd never seen that word before, but he could tell at a glance it wasn't to be found in an English dictionary. He flipped through a few more pages, until he came to a series of photographs. One showed an Indian on one knee with bow and arrow.

Kaoru looked from the book to his mother's face, seeking an explanation.

"It's a book of North American Indian folktales."

"I can see that. What I want to know is, what does it have to do with that article you just had me read?"

Machiko shifted her weight. Her glee at being able to teach her son something came out in her body language.

"The Native Americans had all sorts of myths and traditions, but they had no written language, so most of them come down to us through generations of oral transmission."

She took the book back and paged through it.

"That means that most of these seventy-four tales were gathered and recorded by non-Indians. Look." She pointed to a page. "See? At the beginning of each story there's a notation by the title saying who collected it, when, and where. It also says what tribe the story was handed down in."

Kaoru looked at the title of the story Machiko was pointing to.

"How the Mountaintops Reached the Sun " — the Shopanka tribe

Next there was an entry telling how a white man had come in contact with the Shopanka tribe, heard the story, and written it down. Only then, at last, did the book go on to say how the mountaintops in fact reached the sun.

All seventy-four stories were short, mostly a page or two, and had similar titles-lengthy phrases, not single words.

"Kaoru, I'd like you to read this story."

She had the book open to what seemed to be the thirty-fourth story: at least, it had the number 34 written above the title.

The title turned a light on in his brain.

Another coincidence?

The title was: "Watched by a Multitude of Eyes."

The title was in the passive voice. There was no indication of who was being watched by what.

Kaoru stepped back, groped behind him for a chair, and sat down. He started reading. Without realizing it, he'd slipped into Machiko's world.

Watched by a Multitude of Eyes — the Talikeet tribe

[In 1862, at the height of the Civil War, a covered wagon train was crossing the Southwestern desert on its way west. A white minister, Benjamin Wycliffe, got separated from the wagons and was rescued by the Talikeet. He lived with them for several days.

One calm evening, the Indians gathered around the campfire to hear one of their elders speak. The Reverend Wycliffe happened to be nearby, and he heard the tale. The flames reaching up into the night sky combined with the elder's singsong voice to make a powerful impression on Wycliffe 's mind. He recorded this story that very evening.]

All living things were born from the same source, long long ago. The sea and the rivers and the land, the sun and the moon and the stars, are birth-parents to people and animals, and love them mercifully, but they themselves are contained within the womb of a being larger than themselves. Man feels the land to be filled with spirits because his heart is connected to the heart of this being. When man does something bad, this great being is pained in his heart, and this causes disaster to fall upon man.

Once when the stars were flowing across the sky on the stream of the being's blood, one of the stars came down to earth as a man called Talikeet. He married a lake named Rainier, and they had two sons. They lived together with their children happily on the land in the womb of the great being, never disobeying the will of the spirits.

The brothers grew up strong and were able to help their father and mother. They were skilled and courageous hunters, always bringing home game for their parents.

Then one day, Talikeet's leg began to hurt, and he told this to his wife and children.

They worried about him, but only Talikeet himself knew the reason why his body hurt.

Before he had drifted down to this land, he had been aware of being watched by a multitude of eyes. Men were permitted to hunt animals and eat them. Bigger animals were permitted to catch smaller animals and eat them. But they must not eat too much. And they must not store up too many animals they had killed. They must respect and honour the animals they hunted. To see that this was done, the great being who was also the father of all nature set a huge eye on a mountaintop. The eye which was set on top of the mountain was very large, but it was the only one, so it could not watch all men in all directions at all times. Eventually men began to hide from the eye and do things that went against the will of the great being.

Then the great being placed eyes within men's bodies so that they could not escape his sight.

"It is that eye which is causing me pain now," Talikeet explained to his wife and children.

"But, Father, I do not think you have disobeyed the will of the great being."

"I'm sure I did without realizing it," said Talikeet.

Then he died.

The brothers and their mother were very sad, and they resented the actions of the great being.

Time passed, and then the older brother's waist began to pain him. Then the younger brother's back began to hurt. When they showed each other their bodies, they found fist-sized "eyes", one on the older brother's waist and one on the younger brother's back. They were surprised and asked their mother Rainier for help.

Rainier went down the river and visited the forest spirit. There she learned how to help her sons.

This was the forest spirit's answer. "Go due west and wait for a warrior to appear. Once you are sure of his true intentions, then follow his guidance." So she took her sons and journeyed due west, waiting for a warrior to appear. The "eye" on the older brother's waist grew larger, while the "eye" on the younger brother's back even wept great tears.

Finally a powerful man appeared astride a beast and guided the brothers to a pass in the mountains.

They crossed many rivers. The prairies turned to deserts, and the mountains stretching down from the north broke off. Going around them to the south, they reached a high hill. Standing on the hilltop looking west, they saw water flowing from a mountaintop through a valley until it became a river which flowed into the great sea to the west. Looking east, they saw a like river flowing into the great sea to the east. They were on a bow-shaped ridge connecting valleys on either side of the mountains, at the source of two rivers flowing into the two seas.

At the very highest point of the ridge the warrior dismounted from his beast. They walked to a waterfall and climbed up it. A black cave gaped at the top of the waterfall, and inside the cave lived the Ancient One. The Ancient One told the brothers about the creation of heaven and earth. He knew much about the past, as if he had experienced it all himself, so the older brother asked the Ancient One his age. This was his answer.

"Look at me and decide for yourselves. Tell me what you think."

But the answer came to neither brother, so they could not tell him.

Instead of telling them his age, the Ancient One said, "I have been here since the birth of all things."

The brothers asked him to take away the eyes on the older brother's waist and the younger brother's back. He answered, "Very well. But from this day you must keep watch here instead of me."

Then the Ancient One disappeared. At the same time, the "eyes" fell from their bodies, rolled over the stone floor, and turned into black rocks. The brothers became immortal, and watched over that land. With its rivers flowing into the sea east and west, it was a good land for keeping watch.

As soon as she saw he'd finished reading, Machiko spoke. "You understand what this means, right?"

Kaoru didn't much care for this kind of story. He wasn't a great reader of fiction to begin with, and he found folktales and myths in particular to be too incoherent, too lacking in reality. He had a hard time grasping them even when he did read them.

This one was like that. It developed too fast- what was it trying to say, exactly? The words sounded like they had significance, but they could be interpreted to mean anything. Kaoru felt that, no, he didn't exactly "understand what this means".

"Are the other stories pretty much like this, too?" he asked.

"Sort of."

"This 'Ancient One'. Are we to understand him literally as an old man?"

He imagined the Ancient One was a metaphor for something, along with the Multitude of Watching Eyes. Did the Ancient One represent a longevity zone? What did that make the Watching Eyes? It didn't make sense to him.

"Here's the problem,’ Machiko said, taking out the map included at the end of the book and unfolding it before Kaoru. It was a map of North America, showing the names of the major Indian peoples.

"Folktales and myths: are they completely made-up? According to some scholars, myths are based on historical facts from early in a people's existence. They contain that race's deepest wishes. Traces of the Great Flood, for instance, we find all over the world, and it's common knowledge now that the legend of the ark was at least somewhat based on fact.

"So let's assume that the story you just read, Kaoru, has some element of fact in it. Okay? Now the Talikeet were part of the Okewah people of western Oklahoma." She pointed with her pinky to a point on the map representing the current residence of the Talikeet tribe.

"It says in the story that the brothers went due west from here." She began to move her finger to the left of the page, but then stopped. "Where were they heading? According to the story the hilltop they stood on was at a southern gap in a great mountain range, at the source of two rivers, one flowing to the great western sea and one flowing to the great eastern sea. Geographically, those mountains have to be the Rockies."

She moved her finger along a north-south line, stopping at a point where the Rockies ended their long march down from Canada. The point was directly west from the Talikeet homeland, and just to the south of it stood a mountain of some twelve thousand feet. Which meant that the spot Machiko was pointing to was a huge valley supporting a bow-shaped strip of land. In the desert.

She traced an X over the bow-shaped rise with her finger. Just to the left of that spot could be seen the thin line of the Little Colorado River, which fed into the Colorado River, which flowed into the Gulf of California-the Pacific Ocean. Just to the right of that spot could be seen the uppermost reaches of the Rio Grande, which flowed into the Gulf of Mexico-the Atlantic Ocean. The sources of these two rivers flowing into the world's two great oceans came together at this point, divided by this ridge, part of the Continental Divide.

It was the Four Corners region, where the states of New Mexico, Arizona, Utah, and Colorado met. Site of the negative gravitational anomaly, where a longevity zone might, conjecturally, be located. Not far from the research labs at Los Alamos. Near where the deformed and swollen trees had been found. Right where Kaoru had drawn an X on his gravitational anomaly map ten years ago.

Kaoru felt dizzy. If he stood on that hill and looked west, he'd see water bubbling up from the side of the mountain that would eventually reach the Pacific Ocean; if he looked east he'd see a similar sight. Glittering water slicing its way through a desert wasteland.

The landscape presented itself before his mind's eye. He was standing unsteadily with one foot on either side of that ridge. He'd never been there, but from the contour lines on the map he could imagine it with clarity. But what shook him wasn't that. It was his own guesswork… The longevity zone he'd speculated about was now taking on the air of reality. Something was waiting for him there. The thought struck him with awe. Kaoru no longer cared whether the myth was just a made-up story. What was important was how much of his own hope and desire he could pack into the myth he himself was making. His father wanted it. Reiko wanted it. And now his mother did, too.

Machiko put her hand on Kaoru's knee and spoke to him. Her voice was a whisper, but it was full of assurance.

"You'll go there for me, won't you?"

But there were things he still wasn't sure of.

"You're positive this is where Franz Boer went, are you, Mom?"

"This story, 'Watched by a Multitude of Eyes,' exists in many variations, and the one included in this book is just the most basic. In one version, it's an older brother and a younger sister who meet the Ancient One and are granted immortality. In another version, Rainier has trouble recovering from childbirth, so Talikeet visits the Ancient One and brings back spring water which heals her. Some of the stories have different titles, too. But the description of the place is always the same. Right here. This place has the power to heal illness."

Machiko tapped the point on the map several times. "That's why Franz Boer went there."

"That place…"

"Kaoru, didn't you once show me a map of gravitational anomalies? You'd made a mark in the desert in Arizona or someplace. Can you show me that map again?"

Kaoru wanted to make sure himself. He knew without looking that it was the same place, but still he wanted to check. "Wait a minute," he said, and went to his room.

He hadn't looked at that map for years, so he imagined it would take him a long time to find it. He searched his bookshelves and desk drawers with no luck. It was just a scrap of paper-the proverbial needle in a haystack. But it wasn't a problem. All he had to do was access the same database that he had ten years ago and call up the same information.

He turned on his computer, realizing what an old model it was now. It was on this very screen ten years earlier that the gravitational anomaly map had been displayed.

Kaoru searched his memory for the exact paths he'd taken that night. First, he'd accessed the database on-line. But how had he searched it? First, the category: scientific and technical information. Then, gravity. Under that, gravitational anomalies. Under "area" he chose "worldwide".

Next it asked for a date: what year's gravitational anomalies did he want? He wanted the same map he'd seen ten years before, so he searched for the appropriate year.

Finally, a map appeared on the display. He enlarged the area he'd checked before, the North American desert.

His jaw dropped. The contour lines showed no anomalies in that area whatsoever. Ten years ago, when he'd looked, the negative numbers had gotten larger the closer they'd gotten to that point on the map. The gravitational anomalies had zeroed in on that very spot.

But the map before him now showed no such characteristic. His mother and father had both seen it, he was sure. All three of them had held the maps up to the living room light and seen for themselves that the low-gravity areas contained longevity zones.

Kaoru started again, repeating the same procedure as ten years ago. He did it over and over, but each resulting map held only an unremarkable arrangement of contour lines, a meaningless array of numbers.

He couldn't have misread the map ten years ago. That was impossible. His father's and mother's memories could not be doubted, never mind his own. Looking at that map had led his father promise them a trip to the desert. Kaoru still had the signed agreement in his desk drawer.

So where had that information come from ten years ago?

Kaoru got a pain behind his temples. What had his computer been connected to ten years ago? The thought made the blood rush from his head.

He turned off the computer and closed his eyes. His long-held vague image of the longevity zone in the desert began to rise again before his eyes.

It has to exist. I know it.

The world's outlines were fragile: one poke and it would all crumble into nothingness. But in the face of that fragility Kaoru found assurance. If he'd been able to call up the same information he'd found ten years ago, perhaps he wouldn't have felt this way-perhaps he wouldn't have been able to make up his mind.

He saw a bow-shaped hillock, and rivers swallowed up by the gentle rise of the land. In his imagination he could command the perspective of hawks circling overhead. The deep-carved valleys, the cool green of the trees cradled within them. Maybe the Ancient One still kept watch over the world, flanked by springs that fed into the Pacific and the Atlantic, water that circulated throughout the world like blood or lymph through the body. Incurable illness and ageless immortality; the rising and falling of the tides caused by fluctuations in gravity; life and death. All the contradictions fused into one and rose out of the desert sands. Everything suggested it. Everything whispered to him that he should go there.

Suddenly Machiko was standing behind him. Kaoru turned to look at her, and said, "I'll go, Mom."

"How will you go?"

"I'll have Dad's motorcycle flown to L.A., and then I'll ride out into the desert."

She nodded over and over.